WormBase Tree Display for Variation: WBVar00250889

WBVar00250889 Name: Public_name: tm1928
    Other_name: W09C5.2.1:c.189_374+332del
    HGVSg: CHROMOSOME_I:g.13629484_13630001del
  Sequence_details: SMap: S_parent: Sequence: W09C5
    Flanking_sequences: aggacgcagtggtctgggcaaatcgacatt aatgaaaaacgcctgaaatttcgaattttt
    Mapping_target: W09C5
    Source_location: 7 CHROMOSOME_I 13629483 13630002 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm1928_external
      tm1928_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1928
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00006793
      WBGene00255577
    Transcript: W09C5.2.1 VEP_consequence: splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: W09C5.2.1:c.189_374+332del
        cDNA_position: 195-?
        CDS_position: 189-?
        Protein_position: 63-?
        Intron_number: 3/6
        Exon_number: 3/7
      W09C5.16
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0000352 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. F.P. Finger: Unc particularly in backing Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000640 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. F.P. Finger: Egl. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
    Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 1348/1349-1866/1867 (518 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele