WormBase Tree Display for Variation: WBVar00250900
expand all nodes | collapse all nodes | view schema
WBVar00250900 | Name | Public_name | tm1939 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | CE20165:p.Phe30CysfsTer4 | |||||||
W09C5.2.1:c.89_354del | ||||||||
HGVSg | CHROMOSOME_I:g.13629321_13629649del | |||||||
Sequence_details | SMap | S_parent | Sequence | W09C5 | ||||
Flanking_sequences | agcacaaagaaaatccgaattactggggat | gctgtcaataattcaaagtggtgaggaaaa | ||||||
Mapping_target | W09C5 | |||||||
Source_location | 7 | CHROMOSOME_I | 13629320 | 13629650 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm1939_external | |||||||
tm1939_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 1939 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00006793 | ||||||
Transcript | W09C5.2.1 (11) | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | I | ||||||
Description | Phenotype | WBPhenotype:0000352 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment to the National Bioresource Project of Japan from Dr. F.P. Finger: Unc particularly in backing. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000640 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment to the National Bioresource Project of Japan from Dr. F.P. Finger: Egl. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000643 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment to the National Bioresource Project of Japan from Dr. F.P. Finger: Unc particularly in backing. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | 1185/1186-1514/1515 (329 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |