WormBase Tree Display for Variation: WBVar00250905
expand all nodes | collapse all nodes | view schema
WBVar00250905 | Name | Public_name | tm1944 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | PAR2.3b.1:c.-674-25_-82del | |||||||
PAR2.3a.1:c.119-25_445-13del | ||||||||
HGVSg | CHROMOSOME_III:g.8759976_8760593del | |||||||
Sequence_details | SMap | S_parent | Sequence | PAR2 | ||||
Flanking_sequences | aagaagattttcgggcttctaaaattgata | tttgagctgtagatttctcgtttttttggc | ||||||
Mapping_target | PAR2 | |||||||
Source_location | 7 | CHROMOSOME_III | 8759975 | 8760594 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm1944_external | |||||||
tm1944_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00047359 | |||||||
WBStrain00056770 | ||||||||
Laboratory | FX | |||||||
EN | ||||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 1944 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00019801 | ||||||
Transcript | PAR2.3b.1 | VEP_consequence | splice_acceptor_variant,5_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | PAR2.3b.1:c.-674-25_-82del | |||||||
cDNA_position | ?-752 | |||||||
Intron_number | 1/9 | |||||||
Exon_number | 2/10 | |||||||
PAR2.3a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | PAR2.3a.1:c.119-25_445-13del | |||||||
Intron_number | 2-3/10 | |||||||
Exon_number | 3/11 | |||||||
Interactor (29) | ||||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | III | ||||||
Mapping_data | In_multi_point | 5287 | ||||||
Description | Phenotype | WBPhenotype:0000018 | Paper_evidence | WBPaper00045372 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | aak-1(tm1944) mutants exhibited an increased pharyngeal pumping rate (Figure 2A) | Paper_evidence | WBPaper00045372 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000147 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment to the National Bioresource Project of Japan from: Dr. L. Avery: mildly sensitive to long-term starvation (e.g. 15 days of starvation as L1). | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0001183 | Paper_evidence | WBPaper00045710 | ||||||
WBPaper00045372 | ||||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | The aak-1(tm1944) mutation resulted in reduced fat content under fasting conditions, as determined by Oil Red O staining (Figure 4D,E) | Paper_evidence | WBPaper00045710 | |||||
Curator_confirmed | WBPerson2987 | |||||||
aak-1(tm1944) mutants exhibited reduced fat content compared to controls (Figure 2C) | Paper_evidence | WBPaper00045372 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002276 | Paper_evidence | WBPaper00032396 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | aak-1(tm1944);aak-2(ok524);daf-2(e1370) triple mutant animals exhibited a significantly reduced dauer life span compared to control aak-2(ok524);daf-2(e1370) double mutant animals (Table 1) | Paper_evidence | WBPaper00032396 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Treatment | C. elegans were synchronized and plated at 25 degrees Celsius. Three days later, ~10 dauer larvae were randomly picked into a 20 microliter drop of double-distilled water suspended under a Petri dish cover. A wet tissue was placed in the bottom of the dish to maintain humidity, and the plate was sealed with Parafilm. Dauer longevity was monitored daily, and survival was scored as moving response upon exposure to a focused beam of 425-440 nm light. | Paper_evidence | WBPaper00032396 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Temperature | 25 | Paper_evidence | WBPaper00032396 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Genotype | daf-2(e1370); aak-2(ok524) | Paper_evidence | WBPaper00032396 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0000462 | Paper_evidence | WBPaper00031692 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Paraquat hypersensitivity was not observed in the aak-1(tm1944) deletion mutant | Paper_evidence | WBPaper00031692 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00002747 | Paper_evidence | WBPaper00031692 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000848 | Paper_evidence | WBPaper00038218 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Figure S4d | Paper_evidence | WBPaper00038218 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001182 | Paper_evidence | WBPaper00038218 | ||||||
Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | |||||||
WBPerson2987 | ||||||||
Remark | Comment to the National Bioresource Project of Japan from: Dr. K. Ashrafi: normal Nile Red staining. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
Figure 4a,b | Paper_evidence | WBPaper00038218 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
The aak-1(tm1944) mutation had no effect on the fat-reducing capability of AICAR | Paper_evidence | WBPaper00038218 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Affected_by | Molecule | WBMol:00005453 | Paper_evidence | WBPaper00038218 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Treatment | Fat content of animals was assessed by Nile Red staining | Paper_evidence | WBPaper00038218 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001540 | Paper_evidence | WBPaper00032396 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | aak-1(tm1944);daf-2(e1370) double mutant animals did not exhibit a significantly reduced dauer life span compared to control daf-2(e1370) mutant animals (Table 1) | Paper_evidence | WBPaper00032396 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Treatment | C. elegans were synchronized and plated at 25 degrees Celsius. Three days later, ~10 dauer larvae were randomly picked into a 20 microliter drop of double-distilled water suspended under a Petri dish cover. A wet tissue was placed in the bottom of the dish to maintain humidity, and the plate was sealed with Parafilm. Dauer longevity was monitored daily, and survival was scored as moving response upon exposure to a focused beam of 425-440 nm light. | Paper_evidence | WBPaper00032396 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Temperature | 25 | Paper_evidence | WBPaper00032396 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Genotype | daf-2(e1370) | Paper_evidence | WBPaper00032396 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Reference | WBPaper00038218 | |||||||
WBPaper00031692 | ||||||||
WBPaper00032396 | ||||||||
WBPaper00045372 | ||||||||
WBPaper00045710 | ||||||||
WBPaper00065265 | ||||||||
WBPaper00066013 | ||||||||
Remark | 5139/5140-5757/5758 (618 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |