WormBase Tree Display for Variation: WBVar00250908
expand all nodes | collapse all nodes | view schema
WBVar00250908 | Name | Public_name | tm1947 | |||||
---|---|---|---|---|---|---|---|---|
Sequence_details | SMap | S_parent | Sequence | ZK84 | ||||
Flanking_sequences | ccaagaatagaaaaattggaaacagaggac | ttctgatagtcgcgcttataaaaaagaccg | ||||||
Mapping_target | ZK84 | |||||||
Source_location | 7 | CHROMOSOME_II | 6010313 | 6010791 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm1947_external | |||||||
tm1947_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 1947 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Interactor (41) | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | II | ||||||
Mapping_data | In_multi_point | 5274 | ||||||
Description | Phenotype_not_observed | WBPhenotype:0000012 | Paper_evidence | WBPaper00042184 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "We found that neither deletions in 12 insulins nor knockdown of any of the 40 insulins results in dauers (Fig 1A; Supplemental Table S2)." | Paper_evidence | WBPaper00042184 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000013 | Paper_evidence | WBPaper00042184 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "After dauer-inducing conditions, all mutants analyzed were capable of forming dauers, indicating that they are not dauer defective (Fig 1B). " | Paper_evidence | WBPaper00042184 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. Comment to the NBP from Dr. P. Roy: does not delete CDS. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
RP | ||||||||
WBPhenotype:0000072 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. C. Kenyon to the National Bioresource Project of Japan: grossly normal morphology. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | CF | |||||||
WBPhenotype:0000145 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. C. Kenyon to the National Bioresource Project of Japan: grossly normal fertility. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | CF | |||||||
WBPhenotype:0000639 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. C. Kenyon to the National Bioresource Project of Japan: does not form dauer at 25C. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | CF | |||||||
WBPhenotype:0000640 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from to the National Bioresource Project of Japan from Dr. Q.L. Ch'ng: normal egg-laying. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | QL | |||||||
WBPhenotype:0000643 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from to the National Bioresource Project of Japan from Dr. P. Roy: does not delete CDS. Dr. Q.L. Ch'ng: normal locomotion; Dr. P.W. Sternberg: normal locomotion. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | QL | |||||||
PS | ||||||||
Reference | WBPaper00042184 | |||||||
Remark | 13831/13832-14308/14309 (477 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |