WormBase Tree Display for Variation: WBVar00250915

WBVar00250915 Name: Public_name: tm1955
    HGVSg: CHROMOSOME_III:g.13471626_13472415delinsGATATGAT
  Sequence_details: SMap: S_parent: Sequence: T27E9
    Flanking_sequences: attcctctatcggggtttgatatgatttta ccggagcacttttcctgctcataagtgcct
    Mapping_target: T27E9
    Source_location: 7 CHROMOSOME_III 13471625 13472416 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: GATATGAT
      Deletion
    PCR_product: tm1955_external
      tm1955_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1955
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00012095
    Transcript: T27E9.5.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        cDNA_position: ?-436
        CDS_position: ?-367
        Protein_position: ?-123
        Intron_number: 2-4/11
        Exon_number: 1-5/12
  Isolation: Mutagen: TMP/UV
  Genetics: Map: III
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Dr. M. Han: could not recover mutants. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
  Remark: 9692/9693-GATATGAT-10482/10483 (791 bp deletion + 8 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele