WormBase Tree Display for Variation: WBVar00250946

WBVar00250946 Name: Public_name: tm1986
    HGVSg: CHROMOSOME_IV:g.2388096_2389011delinsCGAAAAATT
  Sequence_details: SMap: S_parent: Sequence: Y38F2AR
    Flanking_sequences: aaattgctctggaaatctgcgaaaaatttc ccgacagacacaccgcggcggcgaacaaac
    Mapping_target: Y38F2AR
    Source_location: 7 CHROMOSOME_IV 2388095 2389013 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: CGAAAAATTT
      Deletion
    PCR_product: tm1986_external
      tm1986_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00007585
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1986
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00197069
      WBGene00197860
      WBGene00168399
      WBGene00021427
    Transcript: Y38F2AR.9.1 VEP_consequence: transcript_ablation
        VEP_impact: HIGH
        Intron_number: 2/3
        Exon_number: 1-4/4
      Y38F2AR.16 VEP_consequence: non_coding_transcript_exon_variant
        VEP_impact: MODIFIER
        cDNA_position: 86-?
        Exon_number: 1/1
      Y38F2AR.15
      Y38F2AR.17 VEP_consequence: non_coding_transcript_exon_variant
        VEP_impact: MODIFIER
        cDNA_position: ?-62
        Exon_number: 1/1
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
  Remark: 56060/56061-CGAAAAATTT-56977/56978 (917 bp deletion + 10 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele