WormBase Tree Display for Variation: WBVar00250961
expand all nodes | collapse all nodes | view schema
WBVar00250961 | Evidence | Paper_evidence | WBPaper00061133 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | tm2001 | ||||||
Other_name | ZK1251.2b.1:c.33+65_89delinsT | |||||||
HGVSg | CHROMOSOME_IV:g.9682366_9682729delinsA | |||||||
Sequence_details | SMap | S_parent | Sequence | ZK1251 | ||||
Flanking_sequences | tgatcatttaaggactccagtgaaaaagga | aataataatcagtcgatcagactgacaggt | ||||||
Mapping_target | ZK1251 | |||||||
Source_location | 7 | CHROMOSOME_IV | 9682365 | 9682730 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Insertion | A | ||||||
Deletion | ||||||||
PCR_product | tm2001_external | |||||||
tm2001_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00048365 | |||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 2001 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00002090 | ||||||
Transcript | ZK1251.2b.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | ZK1251.2b.1:c.33+65_89delinsT | |||||||
cDNA_position | ?-108 | |||||||
CDS_position | ?-89 | |||||||
Protein_position | ?-30 | |||||||
Intron_number | 2/4 | |||||||
Exon_number | 3/5 | |||||||
ZK1251.2a.1 | VEP_consequence | coding_sequence_variant,5_prime_UTR_variant | ||||||
VEP_impact | MODIFIER | |||||||
cDNA_position | ?-56 | |||||||
CDS_position | ?-56 | |||||||
Protein_position | ?-19 | |||||||
Exon_number | 1/3 | |||||||
Interactor | WBInteraction000543195 | |||||||
WBInteraction000543219 | ||||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | IV | ||||||
Description | Phenotype | WBPhenotype:0000061 | Paper_evidence | WBPaper00031230 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Mean lifespan is increased (17.4 0.4 (n = 99/153), P < 0.0001) compared to N2 (14.3 0.3 (n = 176/215; events/total)). | Paper_evidence | WBPaper00031230 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Strain was outcrossed 3 times to N2 before testing. | Paper_evidence | WBPaper00031230 | ||||
Curator_confirmed | WBPerson712 | |||||||
Temperature | 20C | Paper_evidence | WBPaper00031230 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0000643 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comments to the National Bioresource Project of Japan: Dr. P.W. Sternberg: normal locomotion. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
Reference | WBPaper00031230 | |||||||
WBPaper00061133 | ||||||||
Remark | 11135/11136-A-11499/11500 (364 bp deletion + 1 bp insertion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |