WormBase Tree Display for Variation: WBVar00250965

WBVar00250965 Name: Public_name: tm2010
    Other_name (16)
    HGVSg: CHROMOSOME_III:g.5669421_5669828del
  Sequence_details: SMap: S_parent: Sequence: F54E7
    Flanking_sequences: actttagaaaaaaattgaaatttcctagaa accgaagaagcgacgcctgtaaaacaatcc
    Mapping_target: F54E7
    Source_location: 7 CHROMOSOME_III 5669420 5669829 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm2010_external
      tm2010_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2010
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00170085
      WBGene00003918
    Transcript (17)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: III
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 15737/15738-16145/16146 (408 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele