WormBase Tree Display for Variation: WBVar00250967

WBVar00250967 Name: Public_name: tm2016
    Other_name: F39H2.3.1:c.104+6_638del
    HGVSg: CHROMOSOME_I:g.8665085_8665914del
  Sequence_details: SMap: S_parent: Sequence: CHROMOSOME_I
    Flanking_sequences: aaggtttaattacaaatgatgtgacgtatg agaagttctggacgagaagaaaaataaagt
    Mapping_target: CHROMOSOME_I
    Source_location: 7 CHROMOSOME_I 8665084 8665915 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm2016_external
      tm2016_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2016
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00009563
    Transcript: F39H2.3.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: F39H2.3.1:c.104+6_638del
        cDNA_position: ?-638
        CDS_position: ?-638
        Protein_position: ?-213
        Intron_number: 1-4/6
        Exon_number: 2-5/7
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
  Remark: [F39H2] 17101/17102-[K07A12] 382/383 (830 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
    Old Mapping_target F39H2 updated based on the VEP analysis pipeline to CHROMOSOME_I.
  Method: NBP_knockout_allele