WormBase Tree Display for Variation: WBVar00250972

WBVar00250972 Name: Public_name: tm2026
    Other_name: W03A3.2.1:c.1621-81_2063+65del
    HGVSg: CHROMOSOME_III:g.5796555_5797466del
  Sequence_details: SMap: S_parent: Sequence: W03A3
    Flanking_sequences: cggaccaaaagattcaagtgttttaaaaat agaatttgtaatatgtacggtgatgttttc
    Mapping_target: W03A3
    Source_location: 7 CHROMOSOME_III 5796554 5797467 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm2026_external
      tm2026_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00051051
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2026
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00020964
    Transcript: W03A3.2.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: W03A3.2.1:c.1621-81_2063+65del
        Intron_number: 8-11/20
        Exon_number: 9-11/21
  Isolation: Mutagen: TMP/UV
  Genetics: Map: III
  Description: Phenotype: WBPhenotype:0000275 Paper_evidence: WBPaper00051192
        Curator_confirmed: WBPerson9992
      WBPhenotype:0001256 Paper_evidence: WBPaper00031868
        Curator_confirmed: WBPerson712
        Remark: Like N2, animals exhibited RD-51 recruitment onto chromatin after HN2, ICL, treatment. Animals exhibited an increase in the number of foci per nuclei compared to N2. The disappearance of these foci occured with similar kinetics to the wild type. Paper_evidence: WBPaper00031868
            Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: Animals were treated with 150uM HN2 or 300uM HN2. Paper_evidence: WBPaper00031868
              Curator_confirmed: WBPerson712
      WBPhenotype:0001666 Paper_evidence: WBPaper00031868
        Curator_confirmed: WBPerson712
        Remark: Hatch rate was slightly less than N2 after exposure to X-rays (0-120 Gy). Paper_evidence: WBPaper00031868
            Curator_confirmed: WBPerson712
      WBPhenotype:0001796 Paper_evidence: WBPaper00031868
        Curator_confirmed: WBPerson712
        Remark: The hatch rate of animals is significantly lower than N2 after exposure to interstrand cross-link (ICL) inducing agents, nitrogen (HN2), cisplatin (CDDP). Animals showed an increase in apoptotic corpses when compared to N2. Paper_evidence: WBPaper00031868
            Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: L4 animals were treated with 0-150uM HN2 (on plate) or 0-360uM CDDP (in liquid) and hatch rate of progeny was determined for each condition. Paper_evidence: WBPaper00031868
              Curator_confirmed: WBPerson712
      WBPhenotype:0001938 Paper_evidence: WBPaper00046942
        Curator_confirmed: WBPerson24703
        Remark: In polq-1-deficient background only large (>10,000bp) deletions are observed compared to the N2 control (7bp median deletion size). Paper_evidence: WBPaper00046942
            Curator_confirmed: WBPerson24703
    Phenotype_not_observed: WBPhenotype:0000062 Paper_evidence: WBPaper00031868
        Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000275 Paper_evidence: WBPaper00031868
        Curator_confirmed: WBPerson712
        Remark: Hatch rate was not significantly different from N2 after exposure to UV irradiation (J/m2). Paper_evidence: WBPaper00031868
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Paper_evidence: WBPaper00031868
        Curator_confirmed: WBPerson712
      WBPhenotype:0000741 Paper_evidence: WBPaper00031868
        Curator_confirmed: WBPerson712
        Remark: Animals exposed to nitrogen (HN2) showed an increase of apoptotic corpses in the germ line when compared to N2, this increase is dependent on DNA damage checkpoint activation. Paper_evidence: WBPaper00031868
            Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: Animals were treated with 400uM HN2. Paper_evidence: WBPaper00031868
              Curator_confirmed: WBPerson712
  Reference: WBPaper00031868
    WBPaper00046942
    WBPaper00051192
  Remark: 8943/8944-9855/9856 (912 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele