WormBase Tree Display for Variation: WBVar00250973

WBVar00250973 Name: Public_name: tm2027
    HGVSg: CHROMOSOME_IV:g.10985660_10986295del
  Sequence_details: SMap: S_parent: Sequence: Y43E12A
    Flanking_sequences: aagcagcgacttatacactgtaaaaaataa attgtctccaaggcggaattccagcttctc
    Mapping_target: Y43E12A
    Source_location: 7 CHROMOSOME_IV 10985659 10986296 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm2027_external
      tm2027_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2027
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00000866
    Transcript: Y43E12A.1.1 VEP_consequence: coding_sequence_variant,5_prime_UTR_variant
        VEP_impact: MODIFIER
        cDNA_position: ?-311
        CDS_position: ?-294
        Protein_position: ?-98
        Exon_number: 1-2/6
    Interactor: WBInteraction000525087
      WBInteraction000525089
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
    Mapping_data: In_multi_point: 5507
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. J. Kimble to the National Bioresource Project of Japan: homozygotes are viable. Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: JK
              FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. J. Kimble to the National Bioresource Project of Japan: homozygotes are fertile. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: JK
      WBPhenotype:0000699 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan from Dr. A. Hajnal: normal vulval development. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: AH
      WBPhenotype:0001225 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. H. Sawa: non Psa. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: HS
  Remark: 5513/5514-6149/6150 (636 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele