WormBase Tree Display for Variation: WBVar00251013
expand all nodes | collapse all nodes | view schema
WBVar00251013 | Name | Public_name | tm2068 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | D1014.3b.2:c.481_*418del | |||||||
D1014.3b.1:c.481_*418del | ||||||||
D1014.3b.3:c.481_*467del | ||||||||
D1014.3a.1:c.135+346_453del | ||||||||
HGVSg | CHROMOSOME_V:g.8131309_8132066del | |||||||
Sequence_details | SMap | S_parent | Sequence | D1014 | ||||
Flanking_sequences | caagtttctcgtgagcctggaattaatcat | aaaggagaagaacagaaaagtagtgccagc | ||||||
Mapping_target | D1014 | |||||||
Source_location | 7 | CHROMOSOME_V | 8131308 | 8132067 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm2068_external | |||||||
tm2068_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 2068 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00017016 | ||||||
Transcript | D1014.3b.3 | VEP_consequence | stop_lost,3_prime_UTR_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | D1014.3b.3:c.481_*467del | |||||||
cDNA_position | 490-1247 | |||||||
CDS_position | 481-? | |||||||
Protein_position | 161-? | |||||||
Exon_number | 3-4/5 | |||||||
D1014.3b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,stop_lost,3_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | D1014.3b.1:c.481_*418del | |||||||
cDNA_position | 490-1198 | |||||||
CDS_position | 481-? | |||||||
Protein_position | 161-? | |||||||
Intron_number | 4/6 | |||||||
Exon_number | 3-5/7 | |||||||
D1014.3a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | D1014.3a.1:c.135+346_453del | |||||||
cDNA_position | ?-456 | |||||||
CDS_position | ?-453 | |||||||
Protein_position | ?-151 | |||||||
Intron_number | 3-4/7 | |||||||
Exon_number | 4-5/8 | |||||||
D1014.3b.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,stop_lost,3_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | D1014.3b.2:c.481_*418del | |||||||
cDNA_position | 490-1198 | |||||||
CDS_position | 481-? | |||||||
Protein_position | 161-? | |||||||
Intron_number | 4/5 | |||||||
Exon_number | 3-5/6 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | V | ||||||
Description | Phenotype | WBPhenotype:0000057 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. M. Nonet to the National Bioresource Project of Japan: L1/L2 larval lethal. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0000643 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. M. Nonet to the National Bioresource Project of Japan: slightly Unc at hatching and become more Unc over time. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000688 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
Remark | 13100/13101-13858/13859 (758 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |