WormBase Tree Display for Variation: WBVar00251054
expand all nodes | collapse all nodes | view schema
WBVar00251054 | Name | Public_name | tm2114 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | F56E3.3a.1:c.486-5_894del | ||||||||
F56E3.3b.1:c.486-5_894del | |||||||||
HGVSg | CHROMOSOME_X:g.3177192_3177938del | ||||||||
Sequence_details | SMap | S_parent | Sequence | F56E3 | |||||
Flanking_sequences | gagcagccaggttaaaacagagtctcgata | aagacgtttgttttatgtttttgcttttga | |||||||
Mapping_target | F56E3 | ||||||||
Source_location | 7 | CHROMOSOME_X | 3177191 | 3177939 | Inferred_automatically | National_Bioresource_Project | |||
Type_of_mutation | Deletion | ||||||||
PCR_product | tm2114_external | ||||||||
tm2114_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00047316 | ||||||||
Laboratory | FX | ||||||||
Author | Mitani S | ||||||||
DB_info | Database | National_Bioresource_Project | seq | 2114 | |||||
NBP_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00002217 | |||||||
Transcript | F56E3.3b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F56E3.3b.1:c.486-5_894del | ||||||||
cDNA_position | ?-933 | ||||||||
CDS_position | ?-894 | ||||||||
Protein_position | ?-298 | ||||||||
Intron_number | 5-7/25 | ||||||||
Exon_number | 6-8/26 | ||||||||
F56E3.3a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F56E3.3a.1:c.486-5_894del | ||||||||
cDNA_position | ?-927 | ||||||||
CDS_position | ?-894 | ||||||||
Protein_position | ?-298 | ||||||||
Intron_number | 5-7/24 | ||||||||
Exon_number | 6-8/25 | ||||||||
Interactor | WBInteraction000518842 | ||||||||
Isolation | Mutagen | TMP/UV | |||||||
Genetics | Map | X | |||||||
Mapping_data | In_multi_point | 5603 | |||||||
Description | Phenotype | WBPhenotype:0001236 | Paper_evidence | WBPaper00049891 | |||||
Curator_confirmed | WBPerson10038 | ||||||||
Remark | Quoted from paper: "We first validated this glr-1 reporter under control of both Pglr-1 and the glr-1 3'UTR by testing if GFP fluorescence was altered in klp-4/KIF13 trafficking mutants. Briefly, we measured the maximum fluorescence intensity of GFP in the nucleus of the GLR-1-expressing interneuron PVC in wild type and klp-4 (tm2114) loss-of-function mutants (see Materials and Methods). We found that GFP fluorescence increased in klp-4 (tm2114) mutants (Fig 1A), consistent with our previous RT-qPCR results [30]. Because klp-4 mutants have reduced GLR-1 at synapses in the VNC, this data implies that decreased synaptic GLR-1 may trigger a compensatory feedback pathway resulting in increased glr-1 transcript." | Paper_evidence | WBPaper00049891 | ||||||
Curator_confirmed | WBPerson10038 | ||||||||
Phenotype_assay | Strain | WBStrain00047316 | Paper_evidence | WBPaper00049891 | |||||
Curator_confirmed | WBPerson10038 | ||||||||
Control_strain | WBStrain00047309 | Paper_evidence | WBPaper00049891 | ||||||
Curator_confirmed | WBPerson10038 | ||||||||
Genotype | pzEx329[Pglr-1::NLS-GFP::LacZ::glr-1 3'UTR] | Paper_evidence | WBPaper00049891 | ||||||
Curator_confirmed | WBPerson10038 | ||||||||
WBPhenotype:0001278 | Paper_evidence | WBPaper00049891 | |||||||
Curator_confirmed | WBPerson48820 | ||||||||
Remark | Quoted from paper: "Briefly, we measured the maximum fluorescence intensity of GFP in the nucleus of the GLR-1-expressing interneuron PVC in wild type and klp-4 (tm2114) loss-of-function mutants (see Materials and Methods). We found that GFP fluorescence increased in klp-4(tm2114) mutants (Fig 1A), consistent with our previous RT-qPCR results [30]. Because klp-4 mutants have reduced GLR-1 at synapses in the VNC, this data implies that decreased synaptic GLR-1 may trigger a compensatory feedback pathway resulting in increased glr-1 transcript." | Paper_evidence | WBPaper00049891 | ||||||
Curator_confirmed | WBPerson48820 | ||||||||
Variation_effect | Loss_of_function_undetermined_extent | Paper_evidence | WBPaper00049891 | ||||||
Curator_confirmed | WBPerson48820 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005840 | PATO:0000460 | Paper_evidence | WBPaper00049891 | ||||
Curator_confirmed | WBPerson48820 | ||||||||
Phenotype_assay | Strain | WBStrain00047316 | Paper_evidence | WBPaper00049891 | |||||
Curator_confirmed | WBPerson48820 | ||||||||
Control_strain | WBStrain00047309 | Paper_evidence | WBPaper00049891 | ||||||
Curator_confirmed | WBPerson48820 | ||||||||
Genotype | pzEx329[Pglr-1::NLS-GFP::LacZ::glr-1 3'UTR] | Paper_evidence | WBPaper00049891 | ||||||
Curator_confirmed | WBPerson48820 | ||||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | FX | ||||||||
WBPhenotype:0000306 | Paper_evidence | WBPaper00049891 | |||||||
Curator_confirmed | WBPerson10038 | ||||||||
Remark | The klp-4(tm2114) did not significantly change the expression of the nmr-1 promoter reporter (S1 Fig. A /Figure S1A) | Paper_evidence | WBPaper00049891 | ||||||
Curator_confirmed | WBPerson10038 | ||||||||
Phenotype_assay | Control_strain | WBStrain00047811 | Paper_evidence | WBPaper00049891 | |||||
Curator_confirmed | WBPerson10038 | ||||||||
Genotype | pzEx342[Pnmr-1::NLS-GFP::LacZ::unc-54 3'UTR] | Paper_evidence | WBPaper00049891 | ||||||
Curator_confirmed | WBPerson10038 | ||||||||
WBPhenotype:0000436 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comments to the National Bioresource Project of Japan: Dr. C. Bargmann: normal GFP::UNC-2 localization. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | CX | ||||||||
WBPhenotype:0000643 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comments to the National Bioresource Project of Japan: Dr. C. Bargmann: locomotion OK | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | CX | ||||||||
WBPhenotype:0001225 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comment to the National Bioresource Project of Japan: Dr. H. Sawa: 0% Psa. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | HS | ||||||||
WBPhenotype:0002535 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comment from Dr. P. Sengupta to the National Bioresource Project of Japan: normal dye filling. Dr. O. Blacque: dye-filling normal | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | PY | ||||||||
OEB | |||||||||
Reference | WBPaper00049891 | ||||||||
Remark | 5626/5627-6373/6374 (747 bp deletion) | ||||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | |||||||
Method | NBP_knockout_allele |