WormBase Tree Display for Variation: WBVar00251056

WBVar00251056 Name: Public_name: tm2116
    HGVSg: CHROMOSOME_III:g.2814829_2815127del
  Sequence_details: SMap: S_parent: Sequence: Y71H2AM
    Flanking_sequences: ttttacgaaaaaaaaacaactatttttttc attaaatgatgcaaaaagtccgcaatttcg
    Mapping_target: Y71H2AM
    Source_location: 7 CHROMOSOME_III 2814828 2815128 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm2116_external
      tm2116_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2116
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00007000
    Transcript: Y71H2AM.23.1 VEP_consequence: splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        Intron_number: 2/5
        Exon_number: 1-2/6
  Isolation: Mutagen: TMP/UV
  Genetics: Map: III
    Mapping_data: In_multi_point: 5577
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
  Remark: 123500/123501-123799/123800 (299 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele