WormBase Tree Display for Variation: WBVar00251073

WBVar00251073 Name: Public_name: tm2134
    Other_name: Y55B1AL.3b.2:c.-675-209_-539del
      Y55B1AL.3b.1:c.-675-209_-539del
      Y55B1AL.3a.1:c.688-209_824del
    HGVSg: CHROMOSOME_III:g.584726_585071del
  Sequence_details: SMap: S_parent: Sequence: Y55B1AM
    Flanking_sequences: tgtccttgagtaatgagagaatttatgagc acccaacttcggtctgctaattatttagcataccgaacttcggtctgctaattatttagcataccg
    Mapping_target: Y55B1AM
    Source_location: 7 CHROMOSOME_III 584725 585072 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm2134_external
      tm2134_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00051049
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2134
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00021905
    Transcript: Y55B1AL.3b.1 VEP_consequence: splice_acceptor_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: Y55B1AL.3b.1:c.-675-209_-539del
        cDNA_position: ?-1856
        Intron_number: 2/12
        Exon_number: 3/13
      Y55B1AL.3a.1 VEP_consequence: splice_acceptor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: Y55B1AL.3a.1:c.688-209_824del
        cDNA_position: ?-832
        CDS_position: ?-824
        Protein_position: ?-275
        Intron_number: 4/13
        Exon_number: 5/14
      Y55B1AL.3b.2 VEP_consequence: splice_acceptor_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: Y55B1AL.3b.2:c.-675-209_-539del
        cDNA_position: ?-888
        Intron_number: 2/12
        Exon_number: 3/13
  Isolation: Mutagen: TMP/UV
  Genetics: Map: III
  Description: Phenotype: WBPhenotype:0000154 Paper_evidence: WBPaper00031868
        Curator_confirmed: WBPerson712
        Remark: Animals had an average brood size that was slightly reduced compared to N2 (data not shown). Paper_evidence: WBPaper00031868
            Curator_confirmed: WBPerson712
      WBPhenotype:0001256 Paper_evidence: WBPaper00031868
        Curator_confirmed: WBPerson712
        Remark: Like N2, animals exhibited RD-51 recruitment onto chromatin after HN2, ICL, treatment. The average number of foci per nucleus and the percentage of nuclei containing RAD-51 foci was similar to N2 after exposure to 150uM HN2, however was significantly less than N2 at 300uM HN2. Paper_evidence: WBPaper00031868
            Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: Animals were treated with 150uM HN2 or 300uM HN2. Paper_evidence: WBPaper00031868
              Curator_confirmed: WBPerson712
      WBPhenotype:0001666 Paper_evidence: WBPaper00031868
        Curator_confirmed: WBPerson712
        Remark: Hatch rate was slightly less than N2 after exposure to X-rays (0-120 Gy). Paper_evidence: WBPaper00031868
            Curator_confirmed: WBPerson712
      WBPhenotype:0001796 Paper_evidence: WBPaper00031868
        Curator_confirmed: WBPerson712
        Remark: The hatch rate of animals is significantly lower than N2 after exposure to interstrand cross-link (ICL) inducing agents, nitrogen (HN2), cisplatin (CDDP). Animals showed an increase in apoptotic corpses when compared to N2. Paper_evidence: WBPaper00031868
            Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: L4 animals were treated with 0-150uM HN2 (on plate) or 0-360uM CDDP (in liquid) and hatch rate of progeny was determined for each condition. Paper_evidence: WBPaper00031868
              Curator_confirmed: WBPerson712
    Phenotype_not_observed: WBPhenotype:0000062 Paper_evidence: WBPaper00031868
        Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000275 Paper_evidence: WBPaper00031868
        Curator_confirmed: WBPerson712
        Remark: Hatch rate was not significantly different from N2 after exposure to UV irradiation (J/m2). Paper_evidence: WBPaper00031868
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Paper_evidence: WBPaper00031868
        Curator_confirmed: WBPerson712
      WBPhenotype:0000741 Paper_evidence: WBPaper00031868
        Curator_confirmed: WBPerson712
        Remark: Animals exposed to nitrogen (HN2) showed an increase of apoptotic corpses in the germ line when compared to N2, this increase is dependent on DNA damage checkpoint activation. Paper_evidence: WBPaper00031868
            Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: Animals were treated with 400uM HN2. Paper_evidence: WBPaper00031868
              Curator_confirmed: WBPerson712
  Reference: WBPaper00031868
  Remark: 10827/10828-11173/11174 (346 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
    Old Mapping_target Y55B1AL updated based on the VEP analysis pipeline to Y55B1AM.
  Method: NBP_knockout_allele