WormBase Tree Display for Variation: WBVar00251115
expand all nodes | collapse all nodes | view schema
WBVar00251115 | Name | Public_name | tm2180 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | F16A11.3d.1:c.168-28_550+31del | |||||||
HGVSg | CHROMOSOME_I:g.9388635_9389661del | |||||||
Sequence_details | SMap | S_parent | Sequence | F16A11 | ||||
Flanking_sequences | ataaacttttgtttttttttcgcatatggt | tgtgaagaatgagaaaaatatagagaaaaa | ||||||
Mapping_target | F16A11 | |||||||
Source_location | 7 | CHROMOSOME_I | 9388634 | 9389662 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm2180_external | |||||||
tm2180_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 2180 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00008878 | ||||||
Transcript | F16A11.3c.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
Intron_number | 1-3/15 | |||||||
Exon_number | 1-3/16 | |||||||
F16A11.3a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
Intron_number | 2-4/25 | |||||||
Exon_number | 1-4/26 | |||||||
F16A11.3b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
Intron_number | 2-4/24 | |||||||
Exon_number | 1-4/25 | |||||||
F16A11.3d.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F16A11.3d.1:c.168-28_550+31del | |||||||
Intron_number | 2-5/25 | |||||||
Exon_number | 3-5/26 | |||||||
Interactor | WBInteraction000519223 | |||||||
WBInteraction000519224 | ||||||||
WBInteraction000519225 | ||||||||
WBInteraction000519226 | ||||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | I | ||||||
Description | Phenotype | WBPhenotype:0000048 | Paper_evidence | WBPaper00032438 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | tm2180 shows 80-90% hatching at different temperatures. | Paper_evidence | WBPaper00032438 | |||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00032438 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000050 | Paper_evidence | WBPaper00032438 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Polar body extrusion failed in 16% (3/16) of embryos. | Paper_evidence | WBPaper00032438 | |||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00032438 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson48 | |||||||
Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson48 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0000688 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson48 | |||||||
Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson48 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0000777 | Paper_evidence | WBPaper00032438 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Polar body extrusion failed in 16% (3/16) of embryos. | Paper_evidence | WBPaper00032438 | |||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00032438 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001013 | Paper_evidence | WBPaper00061619 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | Worms more susceptible to the Bt247 strain, but not to the Bt679 strain. | Paper_evidence | WBPaper00061619 | |||||
Curator_confirmed | WBPerson557 | |||||||
Phenotype_assay | Treatment | Worms grown on spores derived from the pathogenic Bacillus thuringiensis (Bt) strain MYBt18247 (Bt247) and MYBt18679 (Bt679) in separate experiments. Fourth-instar larvae (L4) were transferred onto 6 cm diameter inoculated with 75 or 100 ul of different concentrations of Bt spore solutions. | Paper_evidence | WBPaper00061619 | ||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0001146 | Paper_evidence | WBPaper00032438 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | 84% (16/19) of ppfr-1(tm2180) had abnormally large polar bodies. | Paper_evidence | WBPaper00032438 | |||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00032438 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001175 | Paper_evidence | WBPaper00032438 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | The ppfr-1 deletion allele is weakly Him, with 0.9% (n= 1150) male offspring. | Paper_evidence | WBPaper00032438 | |||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00032438 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0002057 | Paper_evidence | WBPaper00061619 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | Worms more susceptible to the Bt247 strain, but not to the Bt679 strain. | Paper_evidence | WBPaper00061619 | |||||
Curator_confirmed | WBPerson557 | |||||||
Phenotype_assay | Treatment | Worms grown on spores derived from the pathogenic Bacillus thuringiensis (Bt) strain MYBt18247 (Bt247) and MYBt18679 (Bt679) in separate experiments. Fourth-instar larvae (L4) were transferred onto 6 cm diameter inoculated with 75 or 100 ul of different concentrations of Bt spore solutions. | Paper_evidence | WBPaper00061619 | ||||
Curator_confirmed | WBPerson557 | |||||||
Reference | WBPaper00032438 | |||||||
WBPaper00061619 | ||||||||
Remark | 14161/14162-15188/15189 (1027 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |