WormBase Tree Display for Variation: WBVar00251121

WBVar00251121 Name: Public_name: tm2186
    HGVSg: CHROMOSOME_III:g.9798989_9799362del
  Sequence_details: SMap: S_parent: Sequence: ZK632
    Flanking_sequences: atttttattttaaaaaaacgatgaaaatcc acactatgaagtgcctccttgggcttgtga
    Mapping_target: ZK632
    Source_location: 7 CHROMOSOME_III 9798988 9799363 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm2186_external
      tm2186_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2186
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00014011
    Transcript: ZK632.2.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        cDNA_position: ?-201
        CDS_position: ?-197
        Protein_position: ?-66
        Intron_number: 2/6
        Exon_number: 1-3/7
  Isolation: Mutagen: TMP/UV
  Genetics: Map: III
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
  Remark: 2107/2108-2481/2482 (374 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele