WormBase Tree Display for Variation: WBVar00251138
expand all nodes | collapse all nodes | view schema
WBVar00251138 | Name | Public_name | tm2211 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | Y48G1C.4b.1:c.148+288_332del | |||||||
Y48G1C.4a.1:c.547+288_731del | ||||||||
HGVSg | CHROMOSOME_I:g.52860_53502del | |||||||
Sequence_details | SMap | S_parent | Sequence | Y48G1C | ||||
Flanking_sequences | tcggtatacacgctcaaaaaatcaaaaaat | ttaccccgttttacaaatggggcttttggg | ||||||
Mapping_target | Y48G1C | |||||||
Source_location | 7 | CHROMOSOME_I | 52859 | 53503 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm2211_external | |||||||
tm2211_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 2211 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00021677 | ||||||
Transcript | Y48G1C.4b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | Y48G1C.4b.1:c.148+288_332del | |||||||
cDNA_position | ?-332 | |||||||
CDS_position | ?-332 | |||||||
Protein_position | ?-111 | |||||||
Intron_number | 2-3/4 | |||||||
Exon_number | 3-4/5 | |||||||
Y48G1C.4a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | Y48G1C.4a.1:c.547+288_731del | |||||||
cDNA_position | ?-731 | |||||||
CDS_position | ?-731 | |||||||
Protein_position | ?-244 | |||||||
Intron_number | 4-5/7 | |||||||
Exon_number | 5-6/8 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | I | ||||||
Description | Phenotype | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson48 | |||||||
Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson48 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0000684 | Paper_evidence | WBPaper00040537 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | Germ cell divisions occurred infrequently, and the number of germ cells was decreased. | Paper_evidence | WBPaper00040537 | |||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0000688 | Paper_evidence | WBPaper00040537 | ||||||
Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson48 | |||||||
WBPerson8897 | ||||||||
Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. Comment from Dr. M. Sundaram to the National Bioresource Project of Japan: sterile. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson48 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0001401 | Paper_evidence | WBPaper00040537 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | In pgs-1(tm2211) mutants there were several elongated cristae structures in the mitochondrial matrix of germ cells. | Paper_evidence | WBPaper00040537 | |||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0001893 | Paper_evidence | WBPaper00040537 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | In pgs-1(tm2211) mutants there was reduced mitochondrial membrane potential in germ cells. | Paper_evidence | WBPaper00040537 | |||||
Curator_confirmed | WBPerson557 | |||||||
Phenotype_not_observed | WBPhenotype:0001272 | Paper_evidence | WBPaper00040537 | |||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0001887 | Paper_evidence | WBPaper00040537 | ||||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0001923 | Paper_evidence | WBPaper00040537 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Reference | WBPaper00040537 | |||||||
Remark | 5370/5371-6013/6014 (643 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |