WormBase Tree Display for Variation: WBVar00251142

WBVar00251142 Name: Public_name: tm2216
    Other_name: F02E8.1.1:c.306_511+135del
      F02E8.1.2:c.306_511+135del
    HGVSg: CHROMOSOME_X:g.4470187_4470527del
  Sequence_details: SMap: S_parent: Sequence: F02E8
    Flanking_sequences: ggtcaactacccatacccagccagaccaat cctagactgaaaaagcgaacacagtccctc
    Mapping_target: F02E8
    Source_location: 7 CHROMOSOME_X 4470186 4470528 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm2216_external
      tm2216_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2216
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00000207
    Transcript: F02E8.1.2 VEP_consequence: splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: F02E8.1.2:c.306_511+135del
        cDNA_position: 315-?
        CDS_position: 306-?
        Protein_position: 102-?
        Intron_number: 4/7
        Exon_number: 4/8
      F02E8.1.1 VEP_consequence: splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: F02E8.1.1:c.306_511+135del
        cDNA_position: 315-?
        CDS_position: 306-?
        Protein_position: 102-?
        Intron_number: 4/6
        Exon_number: 4/7
  Isolation: Mutagen: TMP/UV
  Genetics: Map: X
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 22512/22513-22853/22854 (341 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele