WormBase Tree Display for Variation: WBVar00251144
expand all nodes | collapse all nodes | view schema
WBVar00251144 | Name | Public_name | tm2218 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | B0024.14f.1:c.634+11_767delinsA | |||||||
B0024.14d.1:c.709+11_842delinsA | ||||||||
B0024.14b.1:c.907+11_1040delinsA | ||||||||
B0024.14a.1:c.709+11_842delinsA | ||||||||
HGVSg | CHROMOSOME_V:g.10324898_10325089delinsT | |||||||
Sequence_details | SMap | S_parent | Sequence | B0024 | ||||
Flanking_sequences | tatttctcgcacatatgagcaccaagttcg | ataaactaacgattcacttttgggcatgtc | ||||||
Mapping_target | B0024 | |||||||
Source_location | 7 | CHROMOSOME_V | 10324897 | 10325090 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Insertion | T | ||||||
Deletion | ||||||||
PCR_product | tm2218_external | |||||||
tm2218_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 2218 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00007103 | ||||||
Transcript | B0024.14b.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | B0024.14b.1:c.907+11_1040delinsA | |||||||
cDNA_position | ?-1108 | |||||||
CDS_position | ?-1040 | |||||||
Protein_position | ?-347 | |||||||
Intron_number | 6/16 | |||||||
Exon_number | 7/17 | |||||||
B0024.14f.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | B0024.14f.1:c.634+11_767delinsA | |||||||
cDNA_position | ?-767 | |||||||
CDS_position | ?-767 | |||||||
Protein_position | ?-256 | |||||||
Intron_number | 3/13 | |||||||
Exon_number | 4/14 | |||||||
B0024.14a.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | B0024.14a.1:c.709+11_842delinsA | |||||||
cDNA_position | ?-845 | |||||||
CDS_position | ?-842 | |||||||
Protein_position | ?-281 | |||||||
Intron_number | 5/16 | |||||||
Exon_number | 6/17 | |||||||
B0024.14d.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | B0024.14d.1:c.709+11_842delinsA | |||||||
cDNA_position | ?-842 | |||||||
CDS_position | ?-842 | |||||||
Protein_position | ?-281 | |||||||
Intron_number | 4/14 | |||||||
Exon_number | 5/15 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | V | ||||||
Mapping_data | In_multi_point | 5658 | ||||||
Description | Phenotype | WBPhenotype:0000638 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment to the National Bioresource Project of Japan from Dr. A. Frand: molting defective. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | ARF | |||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0000640 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. P. Bazzicalupo to the National Bioresource Project of Japan: normal egg laying. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | NA | |||||||
WBPhenotype:0000688 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. P. Bazzicalupo to the National Bioresource Project of Japan: normal fertility. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | NA | |||||||
Remark | 38329/38330-T-38521/38522 (192 bp deletion +1 bp insertion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |