WormBase Tree Display for Variation: WBVar00251155

WBVar00251155 Name: Public_name: tm2235
    Other_name: Y110A2AL.13.1:c.21_229del
      CE45876:p.Ala8GlyfsTer2
    HGVSg: CHROMOSOME_II:g.2888622_2888985del
  Sequence_details: SMap: S_parent: Sequence: Y110A2AL
    Flanking_sequences: cacttttgaggatgttaatcgcgtcatcct ggcagcgaattatcggacatctgtgagaat
    Mapping_target: Y110A2AL
    Source_location: 7 CHROMOSOME_II 2888621 2888986 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm2235_external
      tm2235_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2235
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00022448
    Transcript: Y110A2AL.13.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Description: Phenotype_not_observed: WBPhenotype:0000048 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the National Bioresource Project of Japan from Dr. K.F. O'Connell: normal hatching. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: OC
      WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000072 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the National Bioresource Project of Japan from Dr. K.F. O'Connell: normal body shape. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: OC
      WBPhenotype:0000643 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the National Bioresource Project of Japan from Dr. K.F. O'Connell: normal locomotion. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: OC
  Remark: 52164/52165-52528/52529 (364 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele