WormBase Tree Display for Variation: WBVar00251157
expand all nodes | collapse all nodes | view schema
| WBVar00251157 | Name | Public_name | tm2238 | |||||
|---|---|---|---|---|---|---|---|---|
| Sequence_details | SMap | S_parent | Sequence | F22F1 | ||||
| Flanking_sequences | gtcgtgccagcttgtatcacaatttttgga | gtgttcaagctgtcgagttttgtcaaggac | ||||||
| Mapping_target | F22F1 | |||||||
| Source_location | 7 | CHROMOSOME_X | 8153949 | 8154127 | Inferred_automatically | National_Bioresource_Project | ||
| Type_of_mutation | Insertion | TG | ||||||
| Deletion | ||||||||
| PCR_product | tm2238_external | |||||||
| tm2238_internal | ||||||||
| SeqStatus | Sequenced | |||||||
| Variation_type | Allele | |||||||
| Origin | Species | Caenorhabditis elegans | ||||||
| Laboratory | FX | |||||||
| Author | Mitani S | |||||||
| DB_info | Database | National_Bioresource_Project | seq | 2238 | ||||
| NBP_allele | ||||||||
| Status | Live | |||||||
| Affects | Gene | WBGene00003330 | ||||||
| Transcript | F22F1.4 | |||||||
| Isolation | Mutagen | TMP/UV | ||||||
| Genetics | Map | X | ||||||
| Mapping_data | In_multi_point | 5663 | ||||||
| Description | Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||
| Curator_confirmed | WBPerson48 | |||||||
| WBPhenotype:0000072 | Person_evidence | WBPerson7743 | ||||||
| Curator_confirmed | WBPerson48 | |||||||
| Remark | Comments to the National Bioresource Project of Japan: Dr. L. Mathies: normal body morphology | Person_evidence | WBPerson7743 | |||||
| Curator_confirmed | WBPerson48 | |||||||
| WBPhenotype:0000643 | Person_evidence | WBPerson7743 | ||||||
| Curator_confirmed | WBPerson48 | |||||||
| Remark | Comments to the National Bioresource Project of Japan: Dr. L. Mathies: normal locomotion. | Person_evidence | WBPerson7743 | |||||
| Curator_confirmed | WBPerson48 | |||||||
| WBPhenotype:0001355 | Person_evidence | WBPerson7743 | ||||||
| Curator_confirmed | WBPerson48 | |||||||
| Remark | Comments to the National Bioresource Project of Japan: Dr. L. Mathies: normal gonad | Person_evidence | WBPerson7743 | |||||
| Curator_confirmed | WBPerson48 | |||||||
| Remark | 5401/5402-TG-5578/5579 (177 bp deletion + 2 bp insertion) | |||||||
| This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
| Method | NBP_knockout_allele |
