WormBase Tree Display for Variation: WBVar00251161

WBVar00251161 Name: Public_name: tm2244
    Other_name: K03E5.3a.1:c.22+37_216del
    HGVSg: CHROMOSOME_I:g.3410083_3410316del
  Sequence_details: SMap: S_parent: Sequence: K03E5
    Flanking_sequences: ttttttccgagattttcattttttcaatat aatattgtgacacttttcgatattatctac
    Mapping_target: K03E5
    Source_location: 7 CHROMOSOME_I 3410082 3410317 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm2244_external
      tm2244_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2244
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00019362
    Transcript: K03E5.3a.1 VEP_consequence: splice_acceptor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: K03E5.3a.1:c.22+37_216del
        cDNA_position: ?-228
        CDS_position: ?-216
        Protein_position: ?-72
        Intron_number: 2/8
        Exon_number: 3/9
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0001225 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. H. Sawa: Psa Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0001927 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. H. Sawa: extra DTC. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
        EQ_annotations: Anatomy_term: WBbt:0006865 PATO:0000460 Person_evidence: WBPerson7743
                Curator_confirmed: WBPerson712
  Remark: 11171/11172-11405/11406 (234 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele