WormBase Tree Display for Variation: WBVar00251179
expand all nodes | collapse all nodes | view schema
| WBVar00251179 | Name | Public_name | tm2268 | |||||
|---|---|---|---|---|---|---|---|---|
| Other_name | CE35995:p.Asn575LysfsTer7 | |||||||
| K10B4.3.1:c.1723_1969del | ||||||||
| HGVSg | CHROMOSOME_II:g.115170_115465del | |||||||
| Sequence_details | SMap | S_parent | Sequence | K10B4 | ||||
| Flanking_sequences | cgaattgggttattgccgaacattccattt | acgatcattcttgaattccaaaattagggg | ||||||
| Mapping_target | K10B4 | |||||||
| Source_location | 7 | CHROMOSOME_II | 115169 | 115466 | Inferred_automatically | National_Bioresource_Project | ||
| Type_of_mutation | Deletion | |||||||
| PCR_product | tm2268_external | |||||||
| tm2268_internal | ||||||||
| SeqStatus | Sequenced | |||||||
| Variation_type | Allele | |||||||
| Origin | Species | Caenorhabditis elegans | ||||||
| Laboratory | FX | |||||||
| Author | Mitani S | |||||||
| DB_info | Database | National_Bioresource_Project | seq | 2268 | ||||
| NBP_allele | ||||||||
| Status | Live | |||||||
| Affects | Gene | WBGene00019615 | ||||||
| Transcript | K10B4.3.1 (11) | |||||||
| Isolation | Mutagen | TMP/UV | ||||||
| Genetics | Map | II | ||||||
| Description | Phenotype_not_observed | WBPhenotype:0000039 | Person_evidence | WBPerson7743 | ||||
| Curator_confirmed | WBPerson712 | |||||||
| Remark | Comments to the National Bioresource Project of Japan: Dr. S.S. Lee: no obvious lifespan phenotype. | Person_evidence | WBPerson7743 | |||||
| Curator_confirmed | WBPerson712 | |||||||
| Laboratory_evidence | FX | |||||||
| WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||||
| Curator_confirmed | WBPerson712 | |||||||
| Remark | Classified as 'homozygous viable' by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
| Curator_confirmed | WBPerson712 | |||||||
| Laboratory_evidence | FX | |||||||
| WBPhenotype:0000518 | Person_evidence | WBPerson7743 | ||||||
| Curator_confirmed | WBPerson712 | |||||||
| Remark | Comments to the National Bioresource Project of Japan: Dr. S.S. Lee: no obvious developmental. | Person_evidence | WBPerson7743 | |||||
| Curator_confirmed | WBPerson712 | |||||||
| Laboratory_evidence | FX | |||||||
| Remark | 833/834-1129/1130 (296 bp deletion) | |||||||
| This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
| Method | NBP_knockout_allele |
