WormBase Tree Display for Variation: WBVar00251193

WBVar00251193 Name: Public_name: tm2285
    HGVSg: CHROMOSOME_IV:g.8299905_8300376delinsAAATTATTTTTATAATATTTTTATAAAA
  Sequence_details: SMap: S_parent: Sequence: F35H10
    Flanking_sequences: attgcataaaacctactatttttataaatt tatcaaaacatgtgatcggaagatggacag
    Mapping_target: F35H10
    Source_location: 7 CHROMOSOME_IV 8299904 8300377 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: AAATTATTTTTATAATATTTTTATAAAA
      Deletion
    PCR_product: tm2285_external
      tm2285_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2285
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00018071
    Transcript: F35H10.6.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        cDNA_position: ?-307
        CDS_position: ?-302
        Protein_position: ?-101
        Intron_number: 2-4/5
        Exon_number: 1-5/6
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
  Remark: 4108/4109-AAATTATTTTTATAATATTTTTATAAAA-4580/4581 (472 bp deletion + 28 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele