WormBase Tree Display for Variation: WBVar00251193
expand all nodes | collapse all nodes | view schema
WBVar00251193 | Name | Public_name | tm2285 | |||||
---|---|---|---|---|---|---|---|---|
HGVSg | CHROMOSOME_IV:g.8299905_8300376delinsAAATTATTTTTATAATATTTTTATAAAA | |||||||
Sequence_details | SMap | S_parent | Sequence | F35H10 | ||||
Flanking_sequences | attgcataaaacctactatttttataaatt | tatcaaaacatgtgatcggaagatggacag | ||||||
Mapping_target | F35H10 | |||||||
Source_location | 7 | CHROMOSOME_IV | 8299904 | 8300377 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Insertion | AAATTATTTTTATAATATTTTTATAAAA | ||||||
Deletion | ||||||||
PCR_product | tm2285_external | |||||||
tm2285_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 2285 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00018071 | ||||||
Transcript | F35H10.6.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
cDNA_position | ?-307 | |||||||
CDS_position | ?-302 | |||||||
Protein_position | ?-101 | |||||||
Intron_number | 2-4/5 | |||||||
Exon_number | 1-5/6 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | IV | ||||||
Description | Phenotype | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson48 | |||||||
Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson48 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0000688 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson48 | |||||||
Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson48 | |||||||
Laboratory_evidence | FX | |||||||
Remark | 4108/4109-AAATTATTTTTATAATATTTTTATAAAA-4580/4581 (472 bp deletion + 28 bp insertion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |