WormBase Tree Display for Variation: WBVar00251195

WBVar00251195 Name: Public_name: tm2287
    Other_name: F53G12.1.1:c.*65_*324del
    HGVSg: CHROMOSOME_I:g.108941_109200del
  Sequence_details: SMap: S_parent: Sequence: F53G12
    Flanking_sequences: ttcaaaatacgtcgctgaagttggcataca ttaaatggacaaggcatttcgaaaaataca
    Mapping_target: F53G12
    Source_location: 7 CHROMOSOME_I 108940 109201 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm2287_external
      tm2287_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2287
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00004274
    Transcript: F53G12.1.1 VEP_consequence: 3_prime_UTR_variant
        VEP_impact: MODIFIER
        HGVSc: F53G12.1.1:c.*65_*324del
        cDNA_position: 714-973
        Exon_number: 6/6
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
  Remark: 1260/1261-1520/1521 (260 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele