WormBase Tree Display for Variation: WBVar00251204
expand all nodes | collapse all nodes | view schema
WBVar00251204 | Name | Public_name | tm2302 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | Y87G2A.4.1:c.345+12_458+2del | |||||||
HGVSg | CHROMOSOME_I:g.13543906_13544144del | |||||||
Sequence_details | SMap | S_parent | Sequence | Y87G2A | ||||
Flanking_sequences | agaaaaacaagagaaaaaattcggccacgt | cgctaatataccttcaattgtgatagccag | ||||||
Mapping_target | Y87G2A | |||||||
Source_location | 7 | CHROMOSOME_I | 13543905 | 13544145 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm2302_external | |||||||
tm2302_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 2302 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00000089 | ||||||
Transcript | Y87G2A.4.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | Y87G2A.4.1:c.345+12_458+2del | |||||||
Intron_number | 4-5/7 | |||||||
Exon_number | 5/8 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | I | ||||||
Description | Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Originally classified as lethal OR sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0000688 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Originally classified as lethal OR sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
Remark | 53122/53123-53361/53362 (239 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |