WormBase Tree Display for Variation: WBVar00251218

WBVar00251218 Name: Public_name: tm2316
    Other_name: W10G11.20.1:c.218_412del
      CE41593:p.Leu73_Ter138delinsHis
      W10G11.20.2:c.218_412del
    HGVSg: CHROMOSOME_II:g.3554148_3554443del
  Sequence_details: SMap: S_parent: Sequence: W10G11
    Flanking_sequences: tttttcagacatccggcccatatggatcgc acggagaattccagacacttgtcgccgagc
    Mapping_target: W10G11
    Source_location: 7 CHROMOSOME_II 3554147 3554444 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm2316_external
      tm2316_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2316
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00021149
    Transcript: W10G11.20.2 (11)
      W10G11.20.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
  Remark: 3625/3626-3921/3922 (296 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele