WormBase Tree Display for Variation: WBVar00251233
expand all nodes | collapse all nodes | view schema
WBVar00251233 | Name | Public_name | tm2332 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | H06H21.10a.1:c.2088+84_2187delinsC | |||||||
H06H21.10d.1:c.2193+84_2292delinsC | ||||||||
H06H21.10b.1:c.2088+84_2187delinsC | ||||||||
H06H21.10c.1:c.2088+84_2187delinsC | ||||||||
H06H21.10e.1:c.2193+84_2292delinsC | ||||||||
H06H21.10f.1:c.2193+84_2292delinsC | ||||||||
HGVSg | CHROMOSOME_IV:g.4834332_4834553delinsG | |||||||
Sequence_details | SMap | S_parent | Sequence | H06H21 | ||||
Flanking_sequences | ttcaaatgtgtttcttgtatcttttagctg | aaaaacttgatgtttcaaaaacttgataag | ||||||
Mapping_target | H06H21 | |||||||
Source_location | 7 | CHROMOSOME_IV | 4834331 | 4834554 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Insertion | G | ||||||
Deletion | ||||||||
PCR_product | tm2332_external | |||||||
tm2332_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 2332 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00019166 | ||||||
Transcript | H06H21.10f.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | H06H21.10f.1:c.2193+84_2292delinsC | |||||||
cDNA_position | ?-2292 | |||||||
CDS_position | ?-2292 | |||||||
Protein_position | ?-764 | |||||||
Intron_number | 13/24 | |||||||
Exon_number | 14/25 | |||||||
H06H21.10c.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | H06H21.10c.1:c.2088+84_2187delinsC | |||||||
cDNA_position | ?-2187 | |||||||
CDS_position | ?-2187 | |||||||
Protein_position | ?-729 | |||||||
Intron_number | 11/19 | |||||||
Exon_number | 12/20 | |||||||
H06H21.10b.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | H06H21.10b.1:c.2088+84_2187delinsC | |||||||
cDNA_position | ?-2187 | |||||||
CDS_position | ?-2187 | |||||||
Protein_position | ?-729 | |||||||
Intron_number | 11/21 | |||||||
Exon_number | 12/22 | |||||||
H06H21.10e.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | H06H21.10e.1:c.2193+84_2292delinsC | |||||||
cDNA_position | ?-2292 | |||||||
CDS_position | ?-2292 | |||||||
Protein_position | ?-764 | |||||||
Intron_number | 13/23 | |||||||
Exon_number | 14/24 | |||||||
H06H21.10d.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | H06H21.10d.1:c.2193+84_2292delinsC | |||||||
cDNA_position | ?-2292 | |||||||
CDS_position | ?-2292 | |||||||
Protein_position | ?-764 | |||||||
Intron_number | 13/21 | |||||||
Exon_number | 14/22 | |||||||
H06H21.10a.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | H06H21.10a.1:c.2088+84_2187delinsC | |||||||
cDNA_position | ?-2187 | |||||||
CDS_position | ?-2187 | |||||||
Protein_position | ?-729 | |||||||
Intron_number | 11/22 | |||||||
Exon_number | 12/23 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | IV | ||||||
Description | Phenotype | WBPhenotype:0000031 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comments to the National Bioresource Project of Japan: Dr. M. Han: slow growth. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as 'homozygous viable' by the National Bioresource Project of Japan. Originally classified as lethal OR sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0000138 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comments to the National Bioresource Project of Japan: Dr. M. Han: normal fatty acid composition. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | MH | |||||||
WBPhenotype:0000643 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comments to the National Bioresource Project of Japan: Dr. M. Han: normal locomotion. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0000688 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comments to the National Bioresource Project of Japan: Dr. M. Han: fertile. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0001422 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comments to the National Bioresource Project of Japan: Dr. S. Tuck: no obvious defects in endocytosis | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
Remark | 27298/27299-G-27520/27521 (222 bp deletion + 1 bp insertion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |