WormBase Tree Display for Variation: WBVar00251239
expand all nodes | collapse all nodes | view schema
WBVar00251239 | Name | Public_name | tm2338 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | Y43H11AL.3a.2:c.1428_1803-16del | |||||||
Y43H11AL.3a.1:c.1428_1803-16del | ||||||||
HGVSg | CHROMOSOME_II:g.251865_252393del | |||||||
Sequence_details | SMap | S_parent | Sequence | Y43H11AL | ||||
Flanking_sequences | ggagatctatctttcctgcaaaaaaaaagc | tgattcatagtaacacttgaactctgtgtt | ||||||
Mapping_target | Y43H11AL | |||||||
Source_location | 7 | CHROMOSOME_II | 251864 | 252394 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm2338_external | |||||||
tm2338_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 2338 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00004166 | ||||||
Transcript | Y43H11AL.3a.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | Y43H11AL.3a.2:c.1428_1803-16del | |||||||
cDNA_position | 1540-? | |||||||
CDS_position | 1428-? | |||||||
Protein_position | 476-? | |||||||
Intron_number | 8-9/28 | |||||||
Exon_number | 8-9/29 | |||||||
Y43H11AL.3a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | Y43H11AL.3a.1:c.1428_1803-16del | |||||||
cDNA_position | 1442-? | |||||||
CDS_position | 1428-? | |||||||
Protein_position | 476-? | |||||||
Intron_number | 7-8/27 | |||||||
Exon_number | 7-8/28 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | II | ||||||
Description | Phenotype | WBPhenotype:0000216 | Paper_evidence | WBPaper00038432 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals exhibited extra A/PVM cells along with extra SDQ neurons. Defects were also observed for PHA/PHB, PLM, A/PQR and I2, other cell lineages that have either a sister or aunt that dies, but not lineages that do not. | Paper_evidence | WBPaper00038432 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | zdIs5[Pmec-4::GFP; lin-15(+)] | Paper_evidence | WBPaper00038432 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000688 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as 'sterile' by the National BioResource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as 'homozygous viable' by the National BioResource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
Reference | WBPaper00038432 | |||||||
Remark | 29763/29764-30292/30293 (529 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |