WormBase Tree Display for Variation: WBVar00251259
expand all nodes | collapse all nodes | view schema
WBVar00251259 | Name | Public_name | tm2364 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | CE47796:p.Thr481LysfsTer3 | |||||||
CE47774:p.Thr485LysfsTer3 | ||||||||
T03D8.5c.1:c.1442_1695del | ||||||||
T03D8.5b.1:c.1454_1707del | ||||||||
CE43349:p.Thr489LysfsTer3 | ||||||||
T03D8.5a.1:c.1466_1719del | ||||||||
HGVSg | CHROMOSOME_V:g.20822373_20822673del | |||||||
Sequence_details | SMap | S_parent | Sequence | T03D8 | ||||
Flanking_sequences | cacttttctgaacatagctctgtcattttt | tagaaattacagcaattatcaaaaccaatg | ||||||
Mapping_target | T03D8 | |||||||
Source_location | 7 | CHROMOSOME_V | 20822372 | 20822674 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm2364_external | |||||||
tm2364_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00029479 | |||||||
WBStrain00047981 | ||||||||
WBStrain00047982 | ||||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 2364 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00001547 | ||||||
Transcript | T03D8.5c.1 (11) | |||||||
T03D8.5a.1 (11) | ||||||||
T03D8.5b.1 (11) | ||||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | V | ||||||
Description | Phenotype (11) | |||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0000247 | Paper_evidence | WBPaper00033467 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | gcy-22 animals display significantly weaker attraction to all salts tested, with the exception of ASEL-sensed Na+ | Paper_evidence | WBPaper00033467 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00033467 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000302 | Paper_evidence | WBPaper00033467 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Odortaxis to a point source of the AWC sensed odorant benzaldehyde is similar to the wild-type response (data not shown). | Paper_evidence | WBPaper00033467 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00033467 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001765 | Paper_evidence | WBPaper00037908 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Reference | WBPaper00037088 | |||||||
WBPaper00033467 | ||||||||
WBPaper00042411 | ||||||||
WBPaper00060362 | ||||||||
WBPaper00037908 | ||||||||
Remark | 6535/6536-6836/6837 (301 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |