WormBase Tree Display for Variation: WBVar00251261
expand all nodes | collapse all nodes | view schema
WBVar00251261 | Name | Public_name | tm2366 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | CE36215:p.Arg5_Ter173delinsSer | ||||||||
W06H3.1.1:c.13_517delinsT | |||||||||
HGVSg | CHROMOSOME_V:g.16789391_16789990delinsT | ||||||||
Sequence_details | SMap | S_parent | Sequence | W06H3 | |||||
Flanking_sequences | atttttaattcaaaagtcatgcgtggaagt | gattcgagctattgagcatcacgttcagac | |||||||
Mapping_target | W06H3 | ||||||||
Source_location | 7 | CHROMOSOME_V | 16789390 | 16789992 | Inferred_automatically | National_Bioresource_Project | |||
Type_of_mutation | Insertion | TC | |||||||
Deletion | |||||||||
PCR_product | tm2366_external | ||||||||
tm2366_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | FX | ||||||||
Author | Mitani S | ||||||||
DB_info | Database | National_Bioresource_Project | seq | 2366 | |||||
NBP_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00012315 | |||||||
Transcript | W06H3.1.1 (11) | ||||||||
Interactor | WBInteraction000501298 | ||||||||
WBInteraction000501299 | |||||||||
WBInteraction000501300 | |||||||||
Isolation | Mutagen | TMP/UV | |||||||
Genetics | Map | V | |||||||
Description | Phenotype | WBPhenotype:0000030 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comments to the National Bioresource Project of Japan: Dr. A. van der Bliek: Gro. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000229 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comments to the National Bioresource Project of Japan: Dr. A. van der Bliek: Sma (~20%). | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000673 | Paper_evidence | WBPaper00038057 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The immt-2(tm2366) mutants have smaller brood sizes than wild-type or immt-1(tm1730) animals. | Paper_evidence | WBPaper00038057 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001401 | Paper_evidence | WBPaper00038057 | |||||||
Person_evidence | WBPerson7743 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comments to the National Bioresource Project of Japan: Dr. A. van der Bliek: Connected mitochondria in muscle. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
The immt-2(tm2366) deletion severely disrupts the morphologies of mitochondria in C. elegans hypodermal and muscle cells. immt-2 defects give rise to mitochondria that are generally thinner and more connected than mitochondria in wild-type cells or cells with immt-1 defects. | Paper_evidence | WBPaper00038057 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003675 | PATO:0000460 | Paper_evidence | WBPaper00038057 | ||||
Person_evidence | WBPerson7743 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0007846 | PATO:0000460 | Paper_evidence | WBPaper00038057 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Laboratory_evidence | FX | ||||||||
WBPhenotype:0000643 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comments to the National Bioresource Project of Japan: Dr. A. van der Bliek: normal locomotion. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000688 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comments to the National Bioresource Project of Japan: Dr. A. van der Bliek: fertile. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001400 | Paper_evidence | WBPaper00038057 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | MOMA-1 protein levels were not significantly altered in these worms. | Paper_evidence | WBPaper00038057 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00038057 | ||||||||
WBPaper00065829 | |||||||||
Remark | 2406/2407-TC-3007/3008 (601 bp deletion + 2 bp insertion) | ||||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | |||||||
Method | NBP_knockout_allele |