WormBase Tree Display for Variation: WBVar00251264
expand all nodes | collapse all nodes | view schema
WBVar00251264 | Name | Public_name | tm2371 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | C34D4.14h.1:c.2343+86_3023del | |||||||
C34D4.14e.1:c.2454+86_3134del | ||||||||
C34D4.14g.1:c.2343+86_3035del | ||||||||
C34D4.14d.1:c.2454+86_3128del | ||||||||
C34D4.14e.2:c.2454+86_3134del | ||||||||
C34D4.14b.1:c.2343+86_3029del | ||||||||
C34D4.14a.2:c.2454+86_3140del | ||||||||
C34D4.14c.1:c.2343+86_3017del | ||||||||
C34D4.14a.1:c.2454+86_3140del | ||||||||
C34D4.14f.1:c.2454+86_3146del | ||||||||
HGVSg | CHROMOSOME_IV:g.7140581_7141570del | |||||||
Sequence_details | SMap | S_parent | Sequence | C34D4 | ||||
Flanking_sequences | ttttccatcattgataaaaggccaaaaagc | tcaattattgagatttaactattcaactga | ||||||
Mapping_target | C34D4 | |||||||
Source_location | 7 | CHROMOSOME_IV | 7140580 | 7141571 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm2371_external | |||||||
tm2371_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 2371 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00016405 | ||||||
Transcript | C34D4.14d.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | C34D4.14d.1:c.2454+86_3128del | |||||||
cDNA_position | ?-3234 | |||||||
CDS_position | ?-3128 | |||||||
Protein_position | ?-1043 | |||||||
Intron_number | 9-12/23 | |||||||
Exon_number | 10-13/24 | |||||||
C34D4.14c.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C34D4.14c.1:c.2343+86_3017del | |||||||
cDNA_position | ?-3125 | |||||||
CDS_position | ?-3017 | |||||||
Protein_position | ?-1006 | |||||||
Intron_number | 9-12/23 | |||||||
Exon_number | 10-13/24 | |||||||
C34D4.14h.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C34D4.14h.1:c.2343+86_3023del | |||||||
cDNA_position | ?-3135 | |||||||
CDS_position | ?-3023 | |||||||
Protein_position | ?-1008 | |||||||
Intron_number | 9-12/23 | |||||||
Exon_number | 10-13/24 | |||||||
C34D4.14a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C34D4.14a.1:c.2454+86_3140del | |||||||
cDNA_position | ?-3246 | |||||||
CDS_position | ?-3140 | |||||||
Protein_position | ?-1047 | |||||||
Intron_number | 9-12/23 | |||||||
Exon_number | 10-13/24 | |||||||
C34D4.14a.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C34D4.14a.2:c.2454+86_3140del | |||||||
cDNA_position | ?-3147 | |||||||
CDS_position | ?-3140 | |||||||
Protein_position | ?-1047 | |||||||
Intron_number | 8-11/22 | |||||||
Exon_number | 9-12/23 | |||||||
C34D4.14b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C34D4.14b.1:c.2343+86_3029del | |||||||
cDNA_position | ?-3135 | |||||||
CDS_position | ?-3029 | |||||||
Protein_position | ?-1010 | |||||||
Intron_number | 9-12/23 | |||||||
Exon_number | 10-13/24 | |||||||
C34D4.14f.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C34D4.14f.1:c.2454+86_3146del | |||||||
cDNA_position | ?-3258 | |||||||
CDS_position | ?-3146 | |||||||
Protein_position | ?-1049 | |||||||
Intron_number | 9-12/23 | |||||||
Exon_number | 10-13/24 | |||||||
C34D4.14e.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C34D4.14e.2:c.2454+86_3134del | |||||||
cDNA_position | ?-3140 | |||||||
CDS_position | ?-3134 | |||||||
Protein_position | ?-1045 | |||||||
Intron_number | 8-11/22 | |||||||
Exon_number | 9-12/23 | |||||||
C34D4.14g.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C34D4.14g.1:c.2343+86_3035del | |||||||
cDNA_position | ?-3148 | |||||||
CDS_position | ?-3035 | |||||||
Protein_position | ?-1012 | |||||||
Intron_number | 9-12/23 | |||||||
Exon_number | 10-13/24 | |||||||
C34D4.14e.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C34D4.14e.1:c.2454+86_3134del | |||||||
cDNA_position | ?-3246 | |||||||
CDS_position | ?-3134 | |||||||
Protein_position | ?-1045 | |||||||
Intron_number | 9-12/23 | |||||||
Exon_number | 10-13/24 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | IV | ||||||
Description | Phenotype_not_observed | WBPhenotype:0000030 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comments to the National Bioresource Project of Japan: Dr. A. Dernburg: No defects in growth | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
Comment to the National Bioresource Project of Japan from Dr. A. Dernburg: No defects in growth. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. Comments to the NBP from Dr. A. Dernburg: No defects in growth, or fertility. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0000145 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comments to the National Bioresource Project of Japan: Dr. A. Dernburg: No defects in fertility. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0000688 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment to the National Bioresource Project of Japan from Dr. A. Dernburg: No defects in fertility. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0001499 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comments to the National Bioresource Project of Japan: Dr. A. Dernburg: No defects in meiotic chromosome behavior. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
Comment to the National Bioresource Project of Japan from Dr. A. Dernburg: no defects in meiotic chromosome behavior. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
Remark | 25747/25748-26737/26738 (990 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |