WormBase Tree Display for Variation: WBVar00251267

WBVar00251267 Name: Public_name: tm2374
    Other_name: LLC1.1a.1:c.429-224_532del
    HGVSg: CHROMOSOME_IV:g.14441677_14442004del
  Sequence_details: SMap: S_parent: Sequence: LLC1
    Flanking_sequences: cttgaagagcatcggaaaggtgtccaccga atcgttttttattattttccacaaaaattc
    Mapping_target: LLC1
    Source_location: 7 CHROMOSOME_IV 14441676 14442005 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm2374_external
      tm2374_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2374
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00046719
      WBGene00006606
      WBGene00170228
    Transcript: LLC1.1a.1 VEP_consequence: splice_acceptor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: LLC1.1a.1:c.429-224_532del
        cDNA_position: ?-566
        CDS_position: ?-532
        Protein_position: ?-178
        Intron_number: 3/9
        Exon_number: 4/10
      LLC1.13
      LLC1.75
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
  Remark: 8138/8139-8466/8467 (328 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele