WormBase Tree Display for Variation: WBVar00251280
expand all nodes | collapse all nodes | view schema
WBVar00251280 | Name | Public_name | tm2391 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | F46A9.5.1:c.81+57_358-14del | ||||||||
HGVSg | CHROMOSOME_I:g.9471701_9472136del | ||||||||
Sequence_details | SMap | S_parent | Sequence | CHROMOSOME_I | |||||
Flanking_sequences | tcgttatttttgtctaaaaaaactaaatcg | ttcatatttttaggctgccaactatttgga | |||||||
Mapping_target | CHROMOSOME_I | ||||||||
Source_location | 7 | CHROMOSOME_I | 9471700 | 9472137 | Inferred_automatically | National_Bioresource_Project | |||
Type_of_mutation | Deletion | ||||||||
PCR_product | tm2391_external | ||||||||
tm2391_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | FX | ||||||||
Author | Mitani S | ||||||||
DB_info | Database | National_Bioresource_Project | seq | 2391 | |||||
NBP_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00004807 | |||||||
Transcript | F46A9.5.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F46A9.5.1:c.81+57_358-14del | ||||||||
Intron_number | 2-3/4 | ||||||||
Exon_number | 3/5 | ||||||||
Isolation | Mutagen | TMP/UV | |||||||
Genetics | Map | I | |||||||
Description | Phenotype | WBPhenotype:0000050 | Paper_evidence | WBPaper00032114 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | skr-1(tm2391) animals can not be maintained as a homozygous strain due to embryonic and larval lethality | Paper_evidence | WBPaper00032114 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00032114 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00032114 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000054 | Paper_evidence | WBPaper00032114 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | skr-1(tm2391) animals can not be maintained as a homozygous strain due to embryonic and larval lethality | Paper_evidence | WBPaper00032114 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00032114 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000023 | PATO:0000460 | Paper_evidence | WBPaper00032114 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Classified as lethal or sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | FX | ||||||||
WBPhenotype:0000172 | Paper_evidence | WBPaper00032114 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Hyperplasia of several tissues including the uterus and the spermatheca of the somatic gonad | Paper_evidence | WBPaper00032114 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00032114 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005319 | PATO:0000460 | Paper_evidence | WBPaper00032114 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0006760 | PATO:0000460 | Paper_evidence | WBPaper00032114 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00032114 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Rare skr-1(tm2391) homozygous escapers become uncoordinated sterile adults | Paper_evidence | WBPaper00032114 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00032114 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00032114 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000688 | Paper_evidence | WBPaper00032114 | |||||||
Person_evidence | WBPerson7743 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2021 | |||||||||
Remark | Classified as lethal or sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | FX | ||||||||
Rare skr-1(tm2391) homozygous escapers become uncoordinated sterile adults | Paper_evidence | WBPaper00032114 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00032114 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00032114 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00032114 | ||||||||
Remark | [F46A9]29584/29585-[F30A10]257/258 (435 bp deletion) | ||||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | |||||||
Old Mapping_target F46A9 updated based on the VEP analysis pipeline to CHROMOSOME_I. | |||||||||
Method | NBP_knockout_allele |