WormBase Tree Display for Variation: WBVar00251309

WBVar00251309 Name: Public_name: tm2422
    Other_name: F54C1.2.1:c.222-7_642+2del
    HGVSg: CHROMOSOME_I:g.5003771_5004248del
  Sequence_details: SMap: S_parent: Sequence: F54C1
    Flanking_sequences: gatattatagagattttgaaaacttgataa acgtattattgggacgcagaaaaatgtata
    Mapping_target: F54C1
    Source_location: 7 CHROMOSOME_I 5003770 5004249 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm2422_external
      tm2422_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2422
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00001050
    Transcript: F54C1.2.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: F54C1.2.1:c.222-7_642+2del
        Intron_number: 3-5/6
        Exon_number: 4-5/7
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000673 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. M. Han to the National Bioresource Project of Japan: wild-type brood size. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: MH
      WBPhenotype:0000676 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. M. Han to the National Bioresource Project of Japan: wild-type growth rate. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: MH
      WBPhenotype:0000695 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. M. Han to the National Bioresource Project of Japan: wild-type vulva. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: MH
      WBPhenotype:0002565 Paper_evidence: WBPaper00045830
        Curator_confirmed: WBPerson557
        Remark: The deletion allele dom-3(tm2422) did not show any defect in olfactory learning (data not shown). Paper_evidence: WBPaper00045830
            Curator_confirmed: WBPerson557
        Phenotype_assay: Treatment: Aversive olfactory learning assay using aversive training with P. aeruginosa. Paper_evidence: WBPaper00045830
              Curator_confirmed: WBPerson557
  Reference: WBPaper00045830
  Remark: 15049/15050-15527/15528 (478 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele