WormBase Tree Display for Variation: WBVar00251312

WBVar00251312 Name: Public_name: tm2425
    Other_name: C28G1.3.1:c.1326-4_1876delinsAATTTTGTAATTGGCAAATT
    HGVSg: CHROMOSOME_X:g.8832813_8833590delinsAATTTGCCAATTACAAAATT
  Sequence_details: SMap: S_parent: Sequence: C28G1
    Flanking_sequences: gatcaatgatttcatcaactttgcttcgca aatgaaattgccatcaggaagtttcatgga
    Mapping_target: C28G1
    Source_location: 7 CHROMOSOME_X 8832812 8833591 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: AATTTGCCAATTACAAAATT
      Deletion
    PCR_product: tm2425_external
      tm2425_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2425
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00016188
    Transcript: C28G1.3.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: C28G1.3.1:c.1326-4_1876delinsAATTTTGTAATTGGCAAATT
        cDNA_position: ?-1879
        CDS_position: ?-1876
        Protein_position: ?-626
        Intron_number: 8-10/13
        Exon_number: 9-11/14
  Isolation: Mutagen: TMP/UV
  Genetics: Map: X
  Description: Phenotype: WBPhenotype:0000050 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the National Bioresource Project of Japan from Dr. J. Lee: Emb. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: LJ
      WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Dr. O. Blacque: could not examine Dyf phenotype; Dr. J. Lee: L1 arrest and Emb. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
              OEB
      WBPhenotype:0000081 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the National Bioresource Project of Japan from Dr. J. Lee: L1 arrest and Emb. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: LJ
        EQ_annotations: Life_stage: WBls:0000024 PATO:0000460 Person_evidence: WBPerson7743
                Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 6437/6438-AATTTGCCAATTACAAAATT-7215/7216 (778 bp deletion + 20 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele