WormBase Tree Display for Variation: WBVar00251321

WBVar00251321 Name: Public_name: tm2434
    Other_name: C38D4.3.1:c.4543_5066del
      CE36378:p.Ser1515IlefsTer10
    HGVSg: CHROMOSOME_III:g.4791255_4791901del
  Sequence_details: SMap: S_parent: Sequence: C38D4
    Flanking_sequences: gcaacttctgaggttgttagcaagcagtcg atccagagcaaattccgaatcgatcgatga
    Mapping_target: C38D4
    Source_location: 7 CHROMOSOME_III 4791254 4791902 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm2434_external
      tm2434_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2434
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00003210
    Transcript: C38D4.3.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: III
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 8918/8919-9656/9566 (647 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele