WormBase Tree Display for Variation: WBVar00251353

WBVar00251353 Name: Public_name: tm2469
    Other_name: CE07426:p.Lys40AspfsTer33
      R08C7.3.1:c.118_412del
    HGVSg: CHROMOSOME_IV:g.4446353_4446697del
  Sequence_details: SMap: S_parent: Sequence: R08C7
    Flanking_sequences: ttccctgtcggacgtatccatcgtttcttg gaccacaataaatgctggacatacctcaaa
    Mapping_target: R08C7
    Source_location: 7 CHROMOSOME_IV 4446352 4446698 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm2469_external
      tm2469_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00007140
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2469
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00019947
    Transcript: R08C7.3.1 (11)
    Interactor: WBInteraction000535427
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Paper_evidence: WBPaper00035328
          WBPaper00044623
        Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson2021
          WBPerson712
          WBPerson2693
        Remark: htz-1(tm2469) homozygous progeny of heterozygous mothers are sterile Paper_evidence: WBPaper00035328
            Curator_confirmed: WBPerson2021
          Classified as lethal OR sterile by the National Bioresource Project of Japan. Comment to the NBP from Dr. M. Han: Ste. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: MH
              FX
        Variation_effect: Null: Paper_evidence: WBPaper00035328
            Curator_confirmed: WBPerson2021
      WBPhenotype:0001859 Paper_evidence: WBPaper00035328
        Curator_confirmed: WBPerson2021
        Remark: DCC mislocalization was observed in intestinal nuclei of homozygous htz-1(tm2469) hermaphrodite progeny of heterozygous mothers. The territory occupied by the DCC in these nuclei was significantly more diffuse in appearance than in wild type nuclei Paper_evidence: WBPaper00035328
            Curator_confirmed: WBPerson2021
        Variation_effect: Null: Paper_evidence: WBPaper00035328
            Curator_confirmed: WBPerson2021
    Phenotype_not_observed: WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the NBP from Dr. W.G. Kelly: fertile. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: KW
      WBPhenotype:0001225 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the NBP from Dr. H. Sawa: no Psa phenotype. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: HS
      WBPhenotype:0001383 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the NBP from Dr. W.G. Kelly: histone methylation on the male X chromosome is normal. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: KW
  Reference: WBPaper00035328
    WBPaper00044623
    WBPaper00062199
  Remark: 25290/25291-25635/25636 (345 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele