WormBase Tree Display for Variation: WBVar00251364
expand all nodes | collapse all nodes | view schema
WBVar00251364 | Name | Public_name | tm2482 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | R74.3.1:c.233_384del | |||||||
R74.3.2:c.233_384del | ||||||||
CE40514:p.Ala78GlyfsTer12 | ||||||||
HGVSg | CHROMOSOME_III:g.4194215_4194416del | |||||||
Sequence_details | SMap | S_parent | Sequence | R74 | ||||
Flanking_sequences | aacttaaaaatcgagtcgcagcccaaaatg | gaagagaacaacgaaaacttgatgaacagc | ||||||
Mapping_target | R74 | |||||||
Source_location | 7 | CHROMOSOME_III | 4194214 | 4194417 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm2482_external | |||||||
tm2482_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 2482 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00006959 | ||||||
Transcript | R74.3.1 (11) | |||||||
R74.3.2 (11) | ||||||||
Interactor | WBInteraction000536438 | |||||||
WBInteraction000536440 | ||||||||
WBInteraction000536441 | ||||||||
WBInteraction000536442 | ||||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | III | ||||||
Description | Phenotype | WBPhenotype:0000436 | Paper_evidence | WBPaper00046107 | ||||
Curator_confirmed | WBPerson10038 | |||||||
Remark | From the text: "In xbp-1(tm2482) null mutants (Richardson et al. 2011), Venus::UNC-6 accumulated in the neuronal cell body, as in the ire-1 mutants (Fig. 1H, I). Expression of the activated spliced form of xbp-1 restored the normal distribution of Venus::UNC-6 in both the ire-1 and xbp-1 mutants (Shim et al. 2004; Fig. 1F, G, J, K). These results suggest that xbp-1 splicing is essential for IRE-1-mediated UNC-6 localization. Thus, the IRE-1/XBP-1 pathway is critical for proper axonal distribution of Venus::UNC-6." | Paper_evidence | WBPaper00046107 | |||||
Curator_confirmed | WBPerson10038 | |||||||
From the text: "However, when the glr-1 promoter was used to drive neuronal unc-6 gene expression in unc-6; ire-1 and unc-6; xbp-1 double mutants, UNC-6 was observed only in cell bodies (Fig. 2F, H)." | Paper_evidence | WBPaper00046107 | ||||||
Curator_confirmed | WBPerson10038 | |||||||
Phenotype_assay | Genotype | ghIs9[unc-6p::Venus::unc-6; str-3p::dsRed2] IV | Paper_evidence | WBPaper00046107 | ||||
Curator_confirmed | WBPerson10038 | |||||||
unc-6(ev400); [ghEx15(glr-1p::unc-6::Venus; tph-1p::GFP)] | Paper_evidence | WBPaper00046107 | ||||||
Curator_confirmed | WBPerson10038 | |||||||
WBPhenotype:0001090 | Paper_evidence | WBPaper00040453 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "... we observed that the xbp-1 mutant exhibited larval lethality when grown at 27C, an elevated temperature at which WT N2 C. elegans exhibits a reduced brood size and increased dauer formation (Figure 5C)." | Paper_evidence | WBPaper00040453 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001350 | Paper_evidence | WBPaper00040453 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | xbp-1(tm2482) resulted in increased levels of phosphorylated eIF2α (Figure 2B, S1B) | Paper_evidence | WBPaper00040453 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0001012 | Paper_evidence | WBPaper00040453 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "Likewise, the larval development of the xbp-1 mutant, which is severely compromised on P. aeruginosa at 25C [21], was equivalent to that of WT at 16C (Figure 5A)." | Paper_evidence | WBPaper00040453 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Temperature | 16 | Paper_evidence | WBPaper00040453 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Reference | WBPaper00040453 | |||||||
WBPaper00046107 | ||||||||
Remark | 10355/10356-10557/10558 (202 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |