WormBase Tree Display for Variation: WBVar00251373

WBVar00251373 Name: Public_name: tm2495
    Other_name: C32D5.12.1:c.654_887del
      CE01841:p.Asn218_Glu296delinsLys
    HGVSg: CHROMOSOME_II:g.6356710_6357045del
  Sequence_details: SMap: S_parent: Sequence: C32D5
    Flanking_sequences: aaacggaatgcaacgtgatttagaatgttt tttccagcatatatctgagaaaggatttta
    Mapping_target: C32D5
    Source_location: 7 CHROMOSOME_II 6356709 6357046 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm2495_external
      tm2495_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2495
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00016319
    Transcript: C32D5.12.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 44699/44700-45035/45036 (336 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele