WormBase Tree Display for Variation: WBVar00251466

WBVar00251466 Name: Public_name: tm2612
    Other_name: F54C8.2.1:c.261_*56del
    HGVSg: CHROMOSOME_III:g.9434433_9435062del
  Sequence_details: SMap: S_parent: Sequence: F54C8
    Flanking_sequences: tttgtttcaggtcggcagtaattcaactaa aaaaatttattgcatgaaaatgaatttatt
    Mapping_target: F54C8
    Source_location: 7 CHROMOSOME_III 9434432 9435063 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm2612_external
      tm2612_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2612
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00010036
    Transcript: F54C8.2.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,stop_lost,3_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: F54C8.2.1:c.261_*56del
        cDNA_position: 278-859
        CDS_position: 261-?
        Protein_position: 87-?
        Intron_number: 4/5
        Exon_number: 4-6/6
  Isolation: Mutagen: TMP/UV
  Genetics: Map: III
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
  Remark: 536/537-1166/1167 (630 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele