WormBase Tree Display for Variation: WBVar00251474

WBVar00251474 Name: Public_name: tm2620
    Other_name: CE41008:p.Phe82LeufsTer13
      T03F1.8a.1:c.275_527del
      CE29460:p.Phe93LeufsTer13
      T03F1.8b.1:c.242_494del
    HGVSg: CHROMOSOME_I:g.3859874_3860188del
  Sequence_details: SMap: S_parent: Sequence: T03F1
    Flanking_sequences: aaaaaaggcaaaaaacgctcactttcaact ccagaaactcgttatttttaatcatttcct
    Mapping_target: T03F1
    Source_location: 7 CHROMOSOME_I 3859873 3860189 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm2620_external
      tm2620_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2620
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00020190
    Transcript: T03F1.8b.1 (11)
      T03F1.8a.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 22021/22022-22336/22337 (315 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele