WormBase Tree Display for Variation: WBVar00251488

WBVar00251488 Name: Public_name: tm2635
    Other_name: B0491.3.1:c.393_573+11del
    HGVSg: CHROMOSOME_II:g.11338691_11338882del
  Sequence_details: SMap: S_parent: Sequence: B0491
    Flanking_sequences: ttattaactattttttagaaatttgcatga ttataacggccacgcaaatggagaacagct
    Mapping_target: B0491
    Source_location: 7 CHROMOSOME_II 11338690 11338883 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm2635_external
      tm2635_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2635
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00007190
    Transcript: B0491.3.1 VEP_consequence: splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: B0491.3.1:c.393_573+11del
        cDNA_position: 418-?
        CDS_position: 393-?
        Protein_position: 131-?
        Intron_number: 4/5
        Exon_number: 4/6
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
    Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Comments to the National Bioresource Project of Japan: Dr. H. Sawa: homozygous viable. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
      WBPhenotype:0001225 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Comments to the National Bioresource Project of Japan: Dr. H. Sawa: not Psa Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
  Remark: 11360/11361-11552/11553 (192 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele