WormBase Tree Display for Variation: WBVar00251507

WBVar00251507 Name: Public_name: tm2659
    Other_name: K02F3.1.1:c.447_580del
      CE31028:p.Gln150ProfsTer7
    HGVSg: CHROMOSOME_III:g.854731_854914del
  Sequence_details: SMap: S_parent: Sequence: K02F3
    Flanking_sequences: aggacagaggaaattcgcaaatgaagtcgt accttctgacggagcacattaagaatatat
    Mapping_target: K02F3
    Source_location: 7 CHROMOSOME_III 854730 854915 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm2659_external
      tm2659_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2659
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00006430
    Transcript: K02F3.1.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: III
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
  Remark: 32030/32031-32214/32215 (184 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele