WormBase Tree Display for Variation: WBVar00251529

WBVar00251529 Name: Public_name: tm2682
    Other_name: R05D3.11.1:c.801_1049+8del
    HGVSg: CHROMOSOME_III:g.8376216_8376472del
  Sequence_details: SMap: S_parent: Sequence: R05D3
    Flanking_sequences: cacttttcttgattatccaaatactggatt taatcaaactcacaactgttttgaaagtat
    Mapping_target: R05D3
    Source_location: 7 CHROMOSOME_III 8376215 8376473 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm2682_external
      tm2682_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2682
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00019883
    Transcript: R05D3.11.1 VEP_consequence: splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: R05D3.11.1:c.801_1049+8del
        cDNA_position: 801-?
        CDS_position: 801-?
        Protein_position: 267-?
        Intron_number: 3/9
        Exon_number: 3/10
  Isolation: Mutagen: TMP/UV
  Genetics: Map: III
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
  Remark: 32750/32751-33007/33008 (257 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele