WormBase Tree Display for Variation: WBVar00251537
expand all nodes | collapse all nodes | view schema
WBVar00251537 | Name | Public_name | tm2691 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | CE02308:p.Leu29PhefsTer53 | |||||||
T01E8.4.1:c.87_390del | ||||||||
HGVSg | CHROMOSOME_II:g.10239251_10239602del | |||||||
Sequence_details | SMap | S_parent | Sequence | T01E8 | ||||
Flanking_sequences | accatttcgagcgttttcaatgctccaaag | aattgtcgttgtggtaaataggtgaaaaga | ||||||
Mapping_target | T01E8 | |||||||
Source_location | 7 | CHROMOSOME_II | 10239250 | 10239603 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm2691_external | |||||||
tm2691_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 2691 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00003177 | ||||||
Transcript | T01E8.4.1 (11) | |||||||
Interactor | WBInteraction000519899 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | II | ||||||
Description (2) | ||||||||
Reference | WBPaper00035070 | |||||||
WBPaper00045955 | ||||||||
Remark | 31422/31423-31774/31775 (352 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |