WormBase Tree Display for Variation: WBVar00251543

WBVar00251543 Name: Public_name: tm2697
    Other_name: ZK1128.2b.1:c.673_1131del
      ZK1128.2a.1:c.718_1176del
      CE31861:p.Phe225_Ter377delextTer?
      CE31860:p.Phe240_Ter392delextTer?
    HGVSg: CHROMOSOME_III:g.10115884_10116440del
  Sequence_details: SMap: S_parent: Sequence: ZK1128
    Flanking_sequences: gaattatttgttgatggaggcgaagtagct ggagatggaaaagattcatacacagacgct
    Mapping_target: ZK1128
    Source_location: 7 CHROMOSOME_III 10115883 10116441 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm2697_external
      tm2697_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2697
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00014228
    Transcript: ZK1128.2b.1 (11)
      ZK1128.2a.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: III
  Description: Phenotype: WBPhenotype:0000052 Paper_evidence: WBPaper00034719
        Curator_confirmed: WBPerson2021
        Remark: At 25C, mett-10 animals are Mel Paper_evidence: WBPaper00034719
            Curator_confirmed: WBPerson2021
        Recessive: Paper_evidence: WBPaper00034719
          Curator_confirmed: WBPerson2021
        Variation_effect: Probable_null_via_phenotype: Paper_evidence: WBPaper00034719
            Curator_confirmed: WBPerson2021
        Temperature_sensitive: Heat_sensitive: 25C Paper_evidence: WBPaper00034719
              Curator_confirmed: WBPerson2021
        Maternal
      WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
      WBPhenotype:0000688 Paper_evidence: WBPaper00034719
        Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
          WBPerson2021
        Remark: Comments from Dr. T. Schedl to the National Bioresource Project of Japan: in frame deletion. Strain is a ts sterile/Pvl. At 20 C, the strain is fertile with about 10% penetrance of the Pvl. At 25 C, the strain is 100% sterile, with close to 90% penetrance of the Pvl. Originally classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: BS
          At 25C, mett-10 animals are sterile (Ste) Paper_evidence: WBPaper00034719
            Curator_confirmed: WBPerson2021
        Penetrance: Complete: At 20 C, the strain is fertile. At 25 C, the strain is 100% sterile. Person_evidence: WBPerson7743
              Curator_confirmed: WBPerson712
        Recessive: Paper_evidence: WBPaper00034719
          Curator_confirmed: WBPerson2021
        Variation_effect: Probable_null_via_phenotype: Paper_evidence: WBPaper00034719
            Curator_confirmed: WBPerson2021
        Temperature_sensitive: Heat_sensitive: 25 Person_evidence: WBPerson7743
              Curator_confirmed: WBPerson712
            25C Paper_evidence: WBPaper00034719
              Curator_confirmed: WBPerson2021
        Phenotype_assay: Temperature: 20, 25 Person_evidence: WBPerson7743
              Curator_confirmed: WBPerson712
      WBPhenotype:0000697 Paper_evidence: WBPaper00034719
        Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
          WBPerson2021
        Remark: Comments from Dr. T. Schedl to the National Bioresource Project of Japan: in frame deletion. Strain is a ts sterile/Pvl. At 20 C, the strain is fertile with about 10% penetrance of the Pvl. At 25 C, the strain is 100% sterile, with close to 90% penetrance of the Pvl. Originally classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: BS
          At 25C, mett-10 animals are Pvl Paper_evidence: WBPaper00034719
            Curator_confirmed: WBPerson2021
        Penetrance: High: At 20 C, the strain is about 10% penetrance Pvl. At 25 C, the strain is close to 90% Pvl. Person_evidence: WBPerson7743
              Curator_confirmed: WBPerson712
        Recessive: Paper_evidence: WBPaper00034719
          Curator_confirmed: WBPerson2021
        Variation_effect: Probable_null_via_phenotype: Paper_evidence: WBPaper00034719
            Curator_confirmed: WBPerson2021
        Temperature_sensitive: Heat_sensitive: 25 Person_evidence: WBPerson7743
              Curator_confirmed: WBPerson712
            25C Paper_evidence: WBPaper00034719
              Curator_confirmed: WBPerson2021
        Phenotype_assay: Temperature: 20, 25 Person_evidence: WBPerson7743
              Curator_confirmed: WBPerson712
  Reference: WBPaper00034719
  Remark: 4946/4947-5503/5504 (557 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele