WormBase Tree Display for Variation: WBVar00251560
expand all nodes | collapse all nodes | view schema
WBVar00251560 | Name | Public_name | tm2715 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | C02F5.4.1:c.157_610del | |||||||
CE38771:p.His53SerfsTer32 | ||||||||
HGVSg | CHROMOSOME_III:g.8244644_8245186del | |||||||
Sequence_details | SMap | S_parent | Sequence | C02F5 | ||||
Flanking_sequences | gttgtatttcagacagtaaagaaagaaaca | agttgcagtcagttcgaagttcgcaagaag | ||||||
Mapping_target | C02F5 | |||||||
Source_location | 7 | CHROMOSOME_III | 8244643 | 8245187 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm2715_external | |||||||
tm2715_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 2715 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00015347 | ||||||
Transcript | C02F5.4.1 (11) | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | III | ||||||
Description | Phenotype | WBPhenotype:0000028 | Paper_evidence | WBPaper00032289 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Pre-mRNA was not cleaved normally, as assayed by qRT-PCR of lin-15A; in addition, transcription termination failed to occur, as assayed by qRT-PCR of lin-15B. | Paper_evidence | WBPaper00032289 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000050 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Originally classified as 'homozygous viable' by the National Bioresource Project of Japan. Comments to the National Bioresource Project of Japan: Dr. T. Blumenthal: at 15 C: ~11% dead egg phenotype, at 20 C: brood size normal and no embryo lethality, at 25 C; ~32% dead egg phenotype; Dr. T. Blumenthal: PNAS 105, 16665 (2008). | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | MH | |||||||
BL | ||||||||
Penetrance | Incomplete | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | 25 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Cold_sensitive | 15 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Temperature | 15, 20, 25 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000136 | Paper_evidence | WBPaper00032289 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | lin-15A transcripts were increased, as assayed by qRT-PCR. | Paper_evidence | WBPaper00032289 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001175 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comments to the National Bioresource Project of Japan: Dr. T. Blumenthal: at 25 C; ~4% male. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | BL | |||||||
Temperature_sensitive | Heat_sensitive | 25 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000030 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comments to the National Bioresource Project of Japan: Dr. M. Han: wild-type growth. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | MH | |||||||
WBPhenotype:0000688 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comments to the National Bioresource Project of Japan: Dr. M. Han: fertile. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | MH | |||||||
WBPhenotype:0000699 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comments to the National Bioresource Project of Japan: Dr. M. Han: normal vulval development. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | MH | |||||||
Reference | WBPaper00032289 | |||||||
Remark | 18178/18179-18721/18722 (543 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |