WormBase Tree Display for Variation: WBVar00251564
expand all nodes | collapse all nodes | view schema
WBVar00251564 | Name | Public_name | tm2720 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | B0024.9a.1:c.264_*43del | |||||||
HGVSg | CHROMOSOME_V:g.10315036_10315253del | |||||||
Sequence_details | SMap | S_parent | Sequence | B0024 | ||||
Flanking_sequences | atcctttcaggtaaacggaagacaaggaag | tttaatggttcatttaaattagaggaataa | ||||||
Mapping_target | B0024 | |||||||
Source_location | 7 | CHROMOSOME_V | 10315035 | 10315254 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm2720_external | |||||||
tm2720_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin (7) | ||||||||
Affects | Gene | WBGene00007100 | ||||||
WBGene00007099 | ||||||||
Transcript | B0024.9b.1 | VEP_consequence | coding_sequence_variant,3_prime_UTR_variant | |||||
VEP_impact | MODIFIER | |||||||
cDNA_position | 186-? | |||||||
CDS_position | 186-? | |||||||
Protein_position | 62-? | |||||||
Exon_number | 3/3 | |||||||
B0024.10.1 | VEP_consequence | 3_prime_UTR_variant | ||||||
VEP_impact | MODIFIER | |||||||
cDNA_position | 1832-? | |||||||
Exon_number | 6/6 | |||||||
B0024.9a.1 | VEP_consequence | stop_lost,3_prime_UTR_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | B0024.9a.1:c.264_*43del | |||||||
cDNA_position | 264-481 | |||||||
CDS_position | 264-? | |||||||
Protein_position | 88-? | |||||||
Exon_number | 3-4/4 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | V | ||||||
Description | Phenotype | WBPhenotype:0000124 | Paper_evidence | WBPaper00040582 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "The conceptual translation of the tm2720 mRNA variant produces a truncated protein (ΔTRX-2) that lacks the C-terminal half of the mature wild-type TRX-2 protein, which contains amino acid residues critical for protein-protein interaction and redox active-site stabilization (11). Consistent with this analysis, recombinant ΔTRX-2 is devoid of enzymatic activity in both the 1,4-dithio-D-threitol (DTT) and reduced nicotinamide adenine dinucleotide phosphate (NADPH)/thioredoxin reductase assay as compared with that of mature full-length TRX-2 (Fig. 1E, F), thus supporting the notion that the tm2720 allele is a loss-of-function allele." | Paper_evidence | WBPaper00040582 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000295 | Paper_evidence | WBPaper00040582 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "No significant differences in sensitivity were found with arsenite, juglone, sodium azide, paraquat or thermal stress treatments (Fig. 5A-E), although the trx-2 (tm2720) mutant was slightly more resistant to thermal stress and trx-2 (tm2720) single and trx-2 (tm2720); trxr-2(tm2047) double mutant showed a slightly higher resistance to paraquat treatment." | Paper_evidence | WBPaper00040582 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Treatment | Animals were grown at 37 degrees Celsius and assayed for survival over time | Paper_evidence | WBPaper00040582 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Temperature | 37 | Paper_evidence | WBPaper00040582 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000461 | Paper_evidence | WBPaper00040582 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "No significant differences in sensitivity were found with arsenite, juglone, sodium azide, paraquat or thermal stress treatments (Fig. 5A-E), although the trx-2 (tm2720) mutant was slightly more resistant to thermal stress and trx-2 (tm2720) single and trx-2 (tm2720); trxr-2(tm2047) double mutant showed a slightly higher resistance to paraquat treatment." | Paper_evidence | WBPaper00040582 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Affected_by | Molecule | WBMol:00002747 | Paper_evidence | WBPaper00040582 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Treatment | Animals were exposed to 4 mM paraquat and assayed for survival over time | Paper_evidence | WBPaper00040582 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_not_observed (11) | ||||||||
Reference | WBPaper00040582 | |||||||
Remark | 28467/28468-28685/28686 (218 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |